Eureka AIR delivers breakthrough ideas for toughest innovation challenges, trusted by R&D personnel around the world.

A SNP molecular marker, PCR primer and application for identifying Mycobacterium tuberculosis complex

A technology of Mycobacterium tuberculosis and molecular markers, which is applied in the field of SNP molecular markers for identifying Mycobacterium tuberculosis complexes, can solve problems such as inability to distinguish strains, and achieve the effects of not needing a long wait, improving the accuracy of identification, and comprehensively identifying

Active Publication Date: 2022-07-12
BEIJING CHEST HOSPITAL CAPITAL MEDICAL UNIV +1
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, due to the high consistency and close kinship of some mycobacterial homologous DNA sequences, the 16S rDNA sequence composition is completely consistent, so it is impossible to distinguish some strains with close kinship, such as Mycobacterium avium and Mycobacterium intracellulare, turtle clam Mycobacterium and Mycobacterium abscessus, Mycobacterium kansasii and Stomach, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A SNP molecular marker, PCR primer and application for identifying Mycobacterium tuberculosis complex
  • A SNP molecular marker, PCR primer and application for identifying Mycobacterium tuberculosis complex
  • A SNP molecular marker, PCR primer and application for identifying Mycobacterium tuberculosis complex

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] Example 1: SNP molecular markers

[0062] The SNP molecular markers selected in the present invention are located on the Hsp65 gene and the rpsA gene. The selected genes are highly conserved within Mycobacterium and have strong diversity among different NTMs. The specific method is to divide the target gene into 10 longer fragments by the online analysis software MEME, and follow the internal differences of MTBC as much as possible. In principle, the difference between MTBC and NTM is as large as possible, and the internal fragment of the gene is selected as the alternative amplification region. Import the selected fragment into MEGA7.0 software for gene alignment, and mark the variable site, that is, SNP, following the principle of SNP diversity at the same site as strong as possible (with two or more base types) ) to filter for backup. The phylogenetic tree constructed according to the target gene shows that the difference is more significant, see figure 1 .

[00...

Embodiment 2

[0083] Example 2: PCR detection of the species of mycobacteria to be tested

[0084] Detection method:

[0085] 1) Extract the genomic DNA of the sample to be tested;

[0086] 2) Take the extracted genomic DNA as a template, utilize the primers shown in SEQ ID No.3-4 and the primers shown in SEQ ID No.5-6 respectively, and amplify the DNA fragment containing the core SNP mark by PCR reaction respectively;

[0087] 3) Detecting PCR amplification products, sequencing the amplification products, analyzing the sequencing results, and interpreting the polymorphism at the SNP site.

[0088] Table 2. PCR primer pairs

[0089]

[0090] SEQ ID No. 1:

[0091] GTGATCAGCGAAGAGGTCGGCCTGACGCTGGAGAACGCCGACCTGTCGCTGCTAGGCAAGGCCCGCAAGGTCGTGGTCACCAAGGACGAGACCACCATCGTCGAGGGCGCCGGTGACACCGACGCCATCGCCGGACGAGTGGCCCAGATCCGCCAGGAGATCGAGAACAGCGACTCCGACTACGACCGTGAGAAGCTGCAGGAGCGGCTGGCCAAGCTGGCCGGTGGTGTCGCGGTGATCAAGGCCGGTGCCGCCACCGAGGTCGAACTCAAGGAGCG;

[0092] SEQ ID No. 2:

[0093]ATCCGAAAGGGTG...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a SNP molecular marker, PCR primer and application for identifying Mycobacterium tuberculosis complex, and relates to the technical field of molecular marker and its application. The SNP molecular markers include SNP1-SNP 8 located on the Hsp65 gene and SNP 9-SNP 15 located on the rpsA gene. The SNP molecular marker provided by the present invention has polymorphisms in 10 kinds of mycobacteria, and the type of the mycobacteria to be detected can be identified by detecting the base type of the mycobacteria on the SNP site.

Description

technical field [0001] The invention relates to the technical field of molecular markers, in particular to a SNP molecular marker, PCR primers and applications for identifying Mycobacterium tuberculosis complexes. Background technique [0002] Tuberculosis (TB), caused by the Mycobacterium tuberculosis complex, is the single most lethal infectious disease. The 2020 WHO report suggests that 2 billion people are infected with TB, accounting for 1 / 3-1 / 4 of the global total, with about 10 million cases and 1.4 million deaths. Correspondingly, there are about 350 million people infected with TB in my country, with 866,000 cases and 39,000 deaths, ranking third in the world. [0003] The Mycobacterium tuberculosis complex belongs to the genus Mycobacterium, which mainly includes Mycobacterium tuberculosis, Mycobacterium bovis, Mycobacterium africanum, Mycobacterium vole and Mycobacterium Kennedy. several species. In the genus Mycobacterium, in addition to the Mycobacterium tube...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/689C12Q1/6858C12Q1/04C12N15/11
CPCC12Q1/689C12Q1/6858C12Q2600/156C12Q2531/113
Inventor 朱晨迪贾俊楠李卫民
Owner BEIJING CHEST HOSPITAL CAPITAL MEDICAL UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com