Penicillium citrinum LB and application in forsythiaside preparation through biotransformation of forsythin

A technology of Penicillium citrinum and biocatalyst, applied in biochemical equipment and methods, methods based on microorganisms, microorganisms, etc., can solve the problems of large enzyme consumption, achieve good specificity, less environmental pollution, and less by-products Effect

CN106282032AActive Publication Date: 2017-01-04ZHEJIANG UNIV OF TECH
5 Cites 3 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Publication Date
2017-01-04

Smart Images

  • Figure 1
    Figure 1
  • Figure 2
    Figure 2
  • Figure 3
    Figure 3
Patent Text Reader

Abstract

The invention relates to penicillium citrinum LB and application in forsythiaside preparation through biotransformation of forsythin. The application comprises the following steps: with the wet thalli obtained by fermentation culture of penicillium citrinum LB as a biocatalyst, forsythin as a substrate and methanol as a cosolvent, forming a transformation system from fermentation liquid containing the wet thalli or by suspending the wet thalli in a buffer solution; performing a transformation reaction under a constant-temperature oscillation condition at 30-35 DEG C and at a speed of 200-250r / min; and after the transformation reaction, separating and purifying the transformed liquid to obtain forsythiaside. When the feed concentration of the substrate is 2g / L, the transformation yield of forsythiaside is 90.5%. The penicillium citrinum LB has the advantages of low nutrition requirements, short fermentation time, strong anti-pollution ability, fast growth, good specificity of transformation reaction, high transformation efficiency and few side products.
Need to check novelty before this filing date? Find Prior Art

Description

[0001] (1) Technical field

[0002] The invention belongs to the technical field of biochemical industry, and relates to a method for preparing forsythiatin by using forsythin as a raw material through biotransformation.

[0003] (2) Background technology

[0004] Forsythiatin (phillygenin), also known as forsythiagenin (CAS No. 487-39-8, molecular formula C 21 h 24 o 6 , with a molecular weight of 372.41), belonging to the class of diepoxy lignans. Forsythiatin has a variety of biological activities, including good antioxidant properties, showing very strong DPPH, ABTS, FRAP free radical scavenging ability and blood lipid-lowering activity; Cancer cells (Hela), Chinese hamster lung fibroblasts (V79) and mouse melanosarcoma cells (B16) have anti-tumor activity in vitro, and can also reduce serum total cholesterol and low-density lipoprotein cholesterol in hyperlipidemic mice, and It can reduce blood lipid levels through oxidative pathways; studies have shown that forsythiat...

Examples

Embodiment 1

[0031] Isolation and screening of embodiment 1 transformed strain

[0032]Collect fertile soil from flower beds and dilute 1×10 with sterile water 6 Spread on the potato dextrose agar plate medium (PDA) after doubling, and cultivate at 28°C for 4 days, pick mold colonies with different colors and shapes and transfer them to fresh PDA plate medium, and place them at 28°C for 3 days. 12 strains with abundant spores were obtained (see Table 1 for the strain numbers), which were stored in a refrigerator at 4°C for later use.

[0033] Pick 2 rings of spores on the plate culture medium of each of the above-mentioned bacterial strains with inoculation loops, inoculate them into 100mL initial fermentation medium (250mL Erlenmeyer bottle), shake and culture at 30°C and 200r / min for 3 days (fermentation broth of different strains The concentration of the dry cells is between 1.42g / L~4.37g / L), and 1mg of forsythin is dissolved in 1mL of methanol and then added to the fermentation broth,...

Embodiment 2

[0044] Embodiment 2: Stability verification of bacterial strain LB transformation

[0045] Using strain LB as the transformed strain, under the fermentation scale of 100mL shake flask, the step of expanding seed cultivation was added, and the fermentation broth containing bacteria was used to transform forsythin to verify the transformation stability of the strain. The specific process steps are as follows:

[0046] (1) Inoculate the bacterial strain LB plate bacterial classification preserved in 4 ℃ of refrigerators on fresh plate culture medium, and plate is cultivated at 28 ℃ of constant temperature for 2 days, and described plate medium composition and preparation method are the same as embodiment 1;

[0047] (2) Use an inoculation loop to take the spores of the strain LB after the activation of step (1) into 50mL seed medium twice, and cultivate them at 30°C and 200r / min constant temperature oscillation for 2 days to obtain a dry cell concentration of 1.83g / min. Seed solu...

Embodiment 3

[0051] Embodiment 3: the taxonomic identification of bacterial strain LB

[0052] The strain LB was inoculated on the potato dextrose agar plate medium, and cultured at 28°C for 2 days to grow colonies. The colony is white and fluffy at the beginning, and then the surface gradually turns gray-green, producing a large number of green conidia, and the back is yellow. Under the microscope, it was observed that the hyphae had a septum, and clusters of blue conidia were produced on the top of the sporophyme, and the conidia spikes were in the broom-like shape unique to Penicillium species.

[0053] The strain LB was submitted to Sangon Bioengineering (Shanghai) Co., Ltd. for 18S rDNA sequencing, and the measured sequence size was 1282bp. The specific sequence (shown in SEQ ID NO: 1) is as follows:

[0054] GCTCATTAAATCAGTTATCGTTTATTTGATAGTACCTTACTACATGGATACCTGTGGTAATTCTAGAGCTAATACATGCTACAAACCCCGACTTCAGGAAGGGGTGTATTTATTAGATAAAAAACCAACGCCCTTCGGGGCTCCTTGGTGAATCATAATAACTTAACGAATCGCATG...