Construction method of strain for producing recombinant protein containing non-natural amino acid and obtained strain

Abstract

The invention provides a construction method of a strain for producing recombinant protein containing non-natural amino acid and the obtained strain. The method comprises the step of transforming the expression of a prfA gene contained in the strain to be controllable. The strain constructed by the method can efficiently produce the intact protein containing the non-natural amino acid, and the strain can maintain high-speed growth while greatly reducing the generation of truncated protein.

Description

technical field

[0001] The invention belongs to the technical field of bioengineering and relates to the construction of strains producing unnatural amino acids. Background technique

[0002] The amber codon (amber) UAG is the stop codon with the lowest usage frequency in E. coli, about 7%. When it is modified to encode a certain unnatural amino acid, it can affect the least endogenous protein, so it is the most frequently A codon used to establish gene codon extension techniques. In common Escherichia coli, the non-natural amino acid tRNA / tRNA synthetase is expressed through the auxiliary plasmid, and then the amber codon is introduced into the reading frame of the recombinant protein through the expression vector, so that the recombinant protein with site-specific insertion of the non-natural amino acid can be produced. However, because the peptide release factor RF1, which recognizes the amber codon as a stop codon, exists in Escherichia coli, the yield of recombinant pr...

Examples

Embodiment 1

[0029] Example 1. Construction of prfA gene knockout plasmid

[0030] Using CRISPR technology, the BL21(DE3) strain (purchased from Thermo Scientific TM , Cat. No.: EC0114) genome (GenBank: AM946981.1) on the prfA gene. Its specific operation is as follows:

[0031]First, two primers, prfA-tgF (SEQ ID NO.1) and prfA-tgR (SEQ ID NO.2), were used to amplify a full-length 2.5kb PCR template using plasmid pTargetF (ADDGENE #62226) as a PCR template. DNA fragments. After the PCR product was purified, the template DNA was cut with DpnI restriction endonuclease, and the digested product was purified and recovered, and then transformed into Top10 competent cells. Recombinant transformants were selected with spectinomycin. And the plasmid pTarget-prfA was obtained by sequencing after selecting the recombinant transformant to extract the plasmid, the sequence of which was SEQ ID NO.3. The guide gRNA expressed by the plasmid can guide the function of the Cas9 protein to cut double-s...

Embodiment 2

[0036] Example 2. Construction of DNA fragments for homologous recombination of the seamless knockout prfA gene

[0037] Using the genomic DNA of BL21(DE3) as a PCR template, primers prfA-5F and prfA-5R were used to amplify the 5' homology arm DNA fragment used for homologous recombination in the process of prfA gene knockout. Using the genomic DNA of BL21(DE3) as a PCR template, primers prfA-3F and prfA-3R were used to amplify the 3' homology arm DNA fragment used for homologous recombination in the process of prfA gene knockout. The DNA fragments of the above two homology arms were purified and recovered and mixed as templates for overlapping PCR, and primers prfA-5F and primers prfA-3R were used for overlapping PCR to obtain a DNA fragment for homologous recombination, which contained about 0.48 kb of 5 ' end homology arm and about 0.45kb 3' end homology arm.

[0038] prfA-5F CCAGGCAGAGCAAGTT (SEQ ID NO. 4) prfA-5R GGGAAGTTGTAAGTCATCTCACGCATTTCAG (SEQ ID...

Embodiment 3

[0039] Example 3. Construction of strains with prfA gene deletion

[0040] First, the plasmid pCAS (ADDGENE, #60847) was introduced into the BL21 (DE3) strain by transformation, and then the obtained strain was used to prepare competent cells. During the preparation of competent cells, 20 mM arabinose was added to the medium to induce the pCAS plasmid. λred system expression. The homologous recombination fragment prepared above was used for co-transformation with the plasmid pTarget-prfA, and a candidate single colony was obtained by co-screening with kanamycin and spectinomycin. Perform colony PCR verification on the candidate single colony, use primer prfA-5uF and primer prfA-3dR for PCR verification, such as figure 1 As shown in A, the correct knockout product is about 1.6kb, while the PCR product of the unsuccessful knockout strain is about 2.3kb, as shown in figure 1 As shown in B, 8 of the 10 selected candidate single colonies met the result of correct knockout. Then ...

technical field

[0001] The invention belongs to the technical field of bioengineering and relates to the construction of strains producing unnatural amino acids. Background technique

[0002] The amber codon (amber) UAG is the stop codon with the lowest usage frequency in E. coli, about 7%. When it is modified to encode a certain unnatural amino acid, it can affect the least endogenous protein, so it is the most frequently A codon used to establish gene codon extension techniques. In common Escherichia coli, the non-natural amino acid tRNA / tRNA synthetase is expressed through the auxiliary plasmid, and then the amber codon is introduced into the reading frame of the recombinant protein through the expression vector, so that the recombinant protein with site-specific insertion of the non-natural amino acid can be produced. However, because the peptide release factor RF1, which recognizes the amber codon as a stop codon, exists in Escherichia coli, the yield of recombinant pr...

Examples

Embodiment 1

[0029] Example 1. Construction of prfA gene knockout plasmid

[0030] Using CRISPR technology, the BL21(DE3) strain (purchased from Thermo Scientific TM , Cat. No.: EC0114) genome (GenBank: AM946981.1) on the prfA gene. Its specific operation is as follows:

[0031]First, two primers, prfA-tgF (SEQ ID NO.1) and prfA-tgR (SEQ ID NO.2), were used to amplify a full-length 2.5kb PCR template using plasmid pTargetF (ADDGENE #62226) as a PCR template. DNA fragments. After the PCR product was purified, the template DNA was cut with DpnI restriction endonuclease, and the digested product was purified and recovered, and then transformed into Top10 competent cells. Recombinant transformants were selected with spectinomycin. And the plasmid pTarget-prfA was obtained by sequencing after selecting the recombinant transformant to extract the plasmid, the sequence of which was SEQ ID NO.3. The guide gRNA expressed by the plasmid can guide the function of the Cas9 protein to cut double-s...

Embodiment 2

[0036] Example 2. Construction of DNA fragments for homologous recombination of the seamless knockout prfA gene

[0037] Using the genomic DNA of BL21(DE3) as a PCR template, primers prfA-5F and prfA-5R were used to amplify the 5' homology arm DNA fragment used for homologous recombination in the process of prfA gene knockout. Using the genomic DNA of BL21(DE3) as a PCR template, primers prfA-3F and prfA-3R were used to amplify the 3' homology arm DNA fragment used for homologous recombination in the process of prfA gene knockout. The DNA fragments of the above two homology arms were purified and recovered and mixed as templates for overlapping PCR, and primers prfA-5F and primers prfA-3R were used for overlapping PCR to obtain a DNA fragment for homologous recombination, which contained about 0.48 kb of 5 ' end homology arm and about 0.45kb 3' end homology arm.

[0038] prfA-5F CCAGGCAGAGCAAGTT (SEQ ID NO. 4) prfA-5R GGGAAGTTGTAAGTCATCTCACGCATTTCAG (SEQ ID...

Embodiment 3

[0039] Example 3. Construction of strains with prfA gene deletion

[0040] First, the plasmid pCAS (ADDGENE, #60847) was introduced into the BL21 (DE3) strain by transformation, and then the obtained strain was used to prepare competent cells. During the preparation of competent cells, 20 mM arabinose was added to the medium to induce the pCAS plasmid. λred system expression. The homologous recombination fragment prepared above was used for co-transformation with the plasmid pTarget-prfA, and a candidate single colony was obtained by co-screening with kanamycin and spectinomycin. Perform colony PCR verification on the candidate single colony, use primer prfA-5uF and primer prfA-3dR for PCR verification, such as figure 1 As shown in A, the correct knockout product is about 1.6kb, while the PCR product of the unsuccessful knockout strain is about 2.3kb, as shown in figure 1 As shown in B, 8 of the 10 selected candidate single colonies met the result of correct knockout. Then ...

Images