Chlamys farreri serine protease inhibitor CfKZSPI gene and its coding protein and application
A technology of serine protease and Chlamys farreri, which is applied in the field of molecular biology technology, can solve the problems such as the death of cultured shellfish and heavy economic losses
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0014] A cloned clam scallop serine protease inhibitor CfKZSPI has the following sequence (see sequence listing)
[0015] The in vitro recombinant expression of the scallop serine protease inhibitor and a kazal domain at its C-terminal of the present invention comprises the following steps:
[0016] a) Extraction of Chlamys farreri total RNA and purification of mRNA;
[0017] b) construction of cDNA library of Chlamys farreri;
[0018] c) Large-scale determination of the EST sequence of the cDNA library of Chlamys farreri;
[0019] d) Homology analysis of Chlamys farreri EST sequence and screening of serine protease inhibitor gene fragments.
[0020] e) Using gene-specific primers ATGTGGCTGTTGCATGTAATGG and ATGGTAATTGCCCTTGTAGA to perform 3' and 5' RACE cloning to obtain the full-length cDNA sequence of the scallop serine protease inhibitor CfKZSPI.
[0021] f) In vitro recombinant expression and activity analysis of a Kazal domain at the C-terminus of Chlamys farreri serin...
Embodiment 2
[0052] Example 2: The potential application of the recombinant expression product in the production of protease inhibitor drugs, the treatment of various human related diseases such as gastric cancer, pancreatic cancer, lung cancer, and the production of feed additives. Description of the drawings: It is a graph showing the inhibitory effect of the recombinant protein rCfKZSPI of a domain of the Kazal-type serine protease inhibitor of Chlamys farreri of the present invention on trypsin.
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More - R&D
- Intellectual Property
- Life Sciences
- Materials
- Tech Scout
- Unparalleled Data Quality
- Higher Quality Content
- 60% Fewer Hallucinations
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2025 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com
