Unlock instant, AI-driven research and patent intelligence for your innovation.

Chlamys farreri serine protease inhibitor CfKZSPI gene and its coding protein and application

A technology of serine protease and Chlamys farreri, which is applied in the field of molecular biology technology, can solve the problems such as the death of cultured shellfish and heavy economic losses

Inactive Publication Date: 2008-02-13
INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] Scallop farming is a pillar industry for mariculture and economic development in coastal areas in my country. However, since 1994, large-scale mortality of farmed shellfish has occurred, causing heavy economic losses.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Chlamys farreri serine protease inhibitor CfKZSPI gene and its coding protein and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0014] A cloned clam scallop serine protease inhibitor CfKZSPI has the following sequence (see sequence listing)

[0015] The in vitro recombinant expression of the scallop serine protease inhibitor and a kazal domain at its C-terminal of the present invention comprises the following steps:

[0016] a) Extraction of Chlamys farreri total RNA and purification of mRNA;

[0017] b) Construction of cDNA library of Chlamys farreri;

[0018] c) Large-scale determination of the EST sequence of the cDNA library of Chlamys farreri;

[0019] d) Homology analysis of Chlamys farreri EST sequence and screening of serine protease inhibitor gene fragments.

[0020] e) Using gene-specific primers ATGTGGCTGTTGCATGTAATGG and ATGGTAATTGCCCTTGTAGA to perform 3' and 5' RACE cloning to obtain the full-length cDNA sequence of the scallop serine protease inhibitor CfKZSPI.

[0021] f) In vitro recombinant expression and activity analysis of a Kazal domain at the C-terminus of Chlamys farreri serin...

Embodiment 2

[0054] Example 2: The potential application of the recombinant expression product in the production of protease inhibitor drugs, the treatment of various human related diseases such as gastric cancer, pancreatic cancer, lung cancer, and the production of feed additives. Description of the drawings: It is a graph showing the inhibition of trypsin by the recombinant protein rCfKZSPI of a structural domain of Chlamys farreri Kazal-type serine protease inhibitor of the present invention.

[0055] (1) Information of SEQ ID No.1

[0056] Sequence features:

[0057] Length: 1788 base pairs

[0058] Type: nucleic acid

[0059] Chain type: double chain

[0060] Topology: Linear

[0061] Molecule type: DNA

[0062] Feature Name: CDS(98-1624)

[0063] Source: Chlamys farreri

[0064] Sequence description:

[0065] GGCACGAGGGTCGCTCACAAGTTTGAAGAGTACGAAGCTATTTGTTCGAGTATAAAGTAAGCCTTTGC

[0066] TTTACTCAGAACTACATTTGATGTCAGCGATGATGTCAAATATCTTGAGTGTGGTCGGATTGTCACTCA

[0067] TTCTAACAC...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
Molecular weightaaaaaaaaaa
Molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention relates to an expression technology of Chlamys farreri serine protease enzyme inhibitor CfKZSPI gene clone and in-vitro reconstitution. Chlamys farreri serine protease enzyme inhibitor CfKZSPI gene has motif sequence in the sequence table SEQ ID No.1. The invention takes use of the constructed Chlamys farreri cDNA library and adopts RACE technology and in-vitro reconstitution expression technology to study Chlamys farreri serine protease enzyme inhibitor CfKZSPI, and the full-length sequence of cDNA of serine protease enzyme inhibitor CfKZSPI is cloned from Chlamys farreri, and the gene has the sequence provided in the sequence list; and pronucleus reconstitution technology is used to express the recombinant protein with strong trypsin inhibition activity.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and relates to in vitro recombination and expression technology of the scallop serine protease inhibitor CfKZSPI gene and a partial sequence thereof, specifically, the method of cloning the scallop serine protease inhibitor CfKZSPI from a scallop cDNA library The full-length cDNA sequence, and a prokaryotic recombinant expression of a Kazal domain encoded by it; it also involves the inhibitory activity of the recombinant product on trypsin, as well as the treatment of human-related diseases and feed additives as an inhibitor of various proteases Potential application value in production. Background technique [0002] The natural immunity of invertebrates generally goes through three steps: first, non-self recognition, second, signal adjustment and amplification, and third, the transcription of various target genes to activate cells and effector response systems to kill and eliminate pat...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C07K14/81A61K38/57A23K1/16A23K20/00
Inventor 宋林生王波赵建民
Owner INST OF OCEANOLOGY - CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More