Chlamys farreri serine protease inhibitor CfKZSPI gene and its coding protein and application
A technology of serine protease and Chlamys farreri, which is applied in the field of molecular biology technology, can solve the problems such as the death of cultured shellfish and heavy economic losses
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0014] A cloned clam scallop serine protease inhibitor CfKZSPI has the following sequence (see sequence listing)
[0015] The in vitro recombinant expression of the scallop serine protease inhibitor and a kazal domain at its C-terminal of the present invention comprises the following steps:
[0016] a) Extraction of Chlamys farreri total RNA and purification of mRNA;
[0017] b) Construction of cDNA library of Chlamys farreri;
[0018] c) Large-scale determination of the EST sequence of the cDNA library of Chlamys farreri;
[0019] d) Homology analysis of Chlamys farreri EST sequence and screening of serine protease inhibitor gene fragments.
[0020] e) Using gene-specific primers ATGTGGCTGTTGCATGTAATGG and ATGGTAATTGCCCTTGTAGA to perform 3' and 5' RACE cloning to obtain the full-length cDNA sequence of the scallop serine protease inhibitor CfKZSPI.
[0021] f) In vitro recombinant expression and activity analysis of a Kazal domain at the C-terminus of Chlamys farreri serin...
Embodiment 2
[0054] Example 2: The potential application of the recombinant expression product in the production of protease inhibitor drugs, the treatment of various human related diseases such as gastric cancer, pancreatic cancer, lung cancer, and the production of feed additives. Description of the drawings: It is a graph showing the inhibition of trypsin by the recombinant protein rCfKZSPI of a structural domain of Chlamys farreri Kazal-type serine protease inhibitor of the present invention.
[0055] (1) Information of SEQ ID No.1
[0056] Sequence features:
[0057] Length: 1788 base pairs
[0058] Type: nucleic acid
[0059] Chain type: double chain
[0060] Topology: Linear
[0061] Molecule type: DNA
[0062] Feature Name: CDS(98-1624)
[0063] Source: Chlamys farreri
[0064] Sequence description:
[0065] GGCACGAGGGTCGCTCACAAGTTTGAAGAGTACGAAGCTATTTGTTCGAGTATAAAGTAAGCCTTTGC
[0066] TTTACTCAGAACTACATTTGATGTCAGCGATGATGTCAAATATCTTGAGTGTGGTCGGATTGTCACTCA
[0067] TTCTAACAC...
PUM
| Property | Measurement | Unit |
|---|---|---|
| Molecular weight | aaaaa | aaaaa |
| Molecular weight | aaaaa | aaaaa |
Abstract
Description
Claims
Application Information
Login to View More 