Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Expression of recombined bovine pancreas ribonucleic acid hydrolase A and purifying method thereof

A technology of pancreatic ribonucleic acid and purification method, which is applied in the field of expression and purification of recombinant bovine pancreatic ribonuclease A, which can solve the problems of lower production efficiency, inability to use ribonuclease products, cost, etc., and achieve improved cutting efficiency, Avoid denaturation and dissolution and dialysis refolding, and reduce costs

Inactive Publication Date: 2008-04-30
NANCHANG UNIV
View PDF0 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, a major problem with this method is that most of the RNaseA produced is an inactive protein polymer, which must undergo complex procedures such as denaturation and dissolution, and then gradually dialysis and refolding to produce a small amount of active RNaseA. Such an operation consumes a lot of time. and cost, and greatly reduces production efficiency
The other is to secrete bovine RNaseA enzyme into the periplasm in the form of fusion protein of maltose binding protein, which has the advantages of solubility and better activity, but the disadvantage of this method is that the yield is too low, less than 1mg / L; It is expressed by Pichia pastoris and secretes recombinant RNaseA into the medium. The problem with this method is that the expression level is low, less than 5 mg / L, and about half of it is glycosylated, and its activity is much lower than that of normal RNaseA
Due to concerns that mad cow disease is a zoonotic disease, we cannot safely use ribonuclease products extracted from bovine pancreas in medicine, food, etc.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0023] The specific embodiment of the process of the present invention is:

[0024] 1. Extract the genomic deoxyribonucleic acid (Genomic DNA) of bovine pancreas.

[0025] 2. According to the nucleic acid sequence of mammalian pancreas RNase A in the NCBI database, find out the conserved sequence through comparative analysis.

[0026] 3. Design appropriate primers according to the conserved sequence and the multiple cloning site on the expression vector pET-20b. Synthesize the following primers:

[0027] Upstream primer: 5'CC CCATGG AATTCGGC AAGGAAACTGCAGCAA 3'

[0028] NcoI Bovine Pancreatic Ribohydrolase Sequence

[0029] Downstream primer: 5'GG CTCGAG CACTGAAGCATCAAAGTGGACTGG 3’

[0030] wxya

[0031] The expression vector pET-20b was chosen because 6 histidine tags can be added to the C-terminus of the target protein to facilitate the purification of the target protein; and it can be secreted into the periplasm of the cell to avoid ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the expression of reforming bovine insulin ribonucleic acid hydrolytic enzyme A (RNaseA) and a depurant method, the genetic expression and the albumen purification technology in modern biology are adopted to perform an improvement to the preparation method of the reforming RNaseA, and the invention provides the preparation method of the reforming RNaseA which can be widely popular in biological medicine, is safe and feasible, and can greatly reduce the manufacturing cost.

Description

technical field [0001] The invention relates to a method for expressing and purifying recombinant bovine pancreatic ribonucleic acid hydrolase A (RNaseA). Background technique [0002] With the rapid development and widespread application of molecular biology, newly established biomedical companies have sprung up like mushrooms after rain. For biomedical companies involved in the production and preparation of products closely related to human health, such as pharmaceuticals, food and vaccines, relevant government departments have strict requirements and standards for their production and preparation processes and raw materials used. For example, in the process of preparing DNA for the production of third-generation vaccines, it is necessary to hydrolyze and remove a large number of intracellular RNAs (ribonucleic acid), which requires the addition of RNaseA (bovine pancreatic ribonuclease A) to complete. Currently known methods for preparing RNaseA are represented by bioche...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/09C12N15/55C12N9/22
Inventor 周兴涛黄国俊
Owner NANCHANG UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products