Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Zebra fish P-selectin gene, encoded protein and application thereof

A gene encoding, zebrafish technology, applied in the field of genetic engineering, can solve problems that have not yet been reported in research

Inactive Publication Date: 2010-09-15
BIOLOGY INST OF SHANDONG ACAD OF SCI
View PDF0 Cites 6 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

So far, the study of zebrafish P-selectin gene has not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Zebra fish P-selectin gene, encoded protein and application thereof
  • Zebra fish P-selectin gene, encoded protein and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Example 1 Sequence Alignment

[0023] Align the mouse P-selectin protein sequence (GenBank: AAA40008) with the zebrafish protein and genome database to obtain the protein sequence with the highest homology (GenBank: XP_001336824), and analyze the nucleotides corresponding to the protein sequence acid sequence.

Embodiment 2

[0024] Embodiment 2 obtains the cDNA sequence of zebrafish P-selectin gene

[0025] 1. Zebrafish total RNA extraction and first-strand cDNA acquisition

[0026] Total RNA was extracted from 3-7 day old zebrafish larvae of AB line using Trizol reagent produced by Invitrogen. The extracted total RNA was transcribed with Promega reverse transcriptase to obtain the first-strand cDNA.

[0027] 2. Primer Design

[0028] Specific primers were designed according to the analyzed nucleic acid sequences as follows.

[0029] F: 5'-CCTGGACTTACCATTACAACATC-3' (SEQ ID NO.3)

[0030] R: 5'-CAAGTACAAAACAACATGAACA-3' (SEQ ID NO. 4).

[0031] 3.PCR amplification

[0032] PCR amplification was performed according to the instruction manual of LA Taq enzyme from Takara Company. Amplification conditions: pre-denaturation at 94°C for 3 minutes; 30 cycles at 94°C for 30 s, 55°C for 30 s, and 72°C for 3 minutes; finally 72°C for 10 minutes. The amplified fragment was purified and recovered, clone...

Embodiment 3

[0037] Embodiment 3 Zebrafish in situ hybridization

[0038] 1. RNA probe synthesis

[0039] According to the full-length cDNA sequence of the P-selectin gene, a 600bp DNA fragment from 679-1278 was selected as a template to synthesize a digoxigenin-labeled RNA probe.

[0040] 1.1 Design primers

[0041] F: CAAGGTCTTGTGAAGTGTGAC (SEQ ID NO. 9)

[0042] R: AAACTCATCGACAGAGTCAT (SEQ ID NO. 10)

[0043] 1.2PCR amplification

[0044] PCR amplification was performed according to the instruction manual of Taq enzyme from Takara Company. The amplification conditions were pre-denatured at 94°C for 5 minutes; followed by 30 cycles at 94°C for 30 s, 68°C for 30 s, and 72°C for 1 min; finally, 72°C for 10 min. The amplified fragment was purified and recovered, and cloned into the pGEM-T vector according to the pGEM-T vector manual of Promega Company, and sequenced after endonuclease detection of the inserted fragment.

[0045] 1.3 Preparation of recombinant plasmid

[0046] The amp...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a zebra fish P-selectin gene and a protein. The nucleotide sequence of the zebra fish P-selectin gene is shown as SEQ ID NO.1, and the encoded protein sequence is shown as SEQ ID NO.2. The zebra fish P-selectin gene can be used for constructing transgenic zebra fishes. The constructed transgenic zebra fishes can be used for researching the generation mechanism of thrombotic diseases and sieving the antithrombotics. The zebra fish P-selectin gene and the encoded gene can be used for preparing drugs for preventing and treating the thrombotic diseases.

Description

technical field [0001] The invention relates to a P-selectin gene derived from zebrafish, its encoded protein and its application, belonging to the technical field of genetic engineering. Background technique [0002] P-selectin, also known as CD62P, granule membrane protein 140 (granular membrane protein 140, GMP140), or platelet activation dependent granule external membrane protein (PADGEM), is an important adhesion molecule of the selectin family. [0003] P-selectin is stored in Weibel-Palade bodies of endothelial cells and α-granules of platelets. There is no expression of P-selectin on the surface of normal endothelial cells and platelets or a state of continuous low expression. When cells are stimulated (LPS, histamine, Thromboxane, ADP, TNF-α, etc.) activation, P-selectin is secreted to the cell surface. [0004] Studies on thrombotic cardiovascular and cerebrovascular diseases have found that the activation of platelets plays a very important role in the occurrenc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C07K14/46A61K48/00A61K38/17A61P7/02A01K67/027
Inventor 刘可春孙桂金王雪王思锋王希敏
Owner BIOLOGY INST OF SHANDONG ACAD OF SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com