Fusion protein HABP-mKate and preparation method and application thereof

A technology of fusion protein and method body, which is applied in the field of genetic engineering, can solve the problems of high extraction cost and incapable of large-scale production, and achieve the effect of simple preparation, low cost and maintaining binding ability

Inactive Publication Date: 2012-05-30
曹利民
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0005] In order to solve the current high cost of direct extraction of HABP and the lack of large-scale production, the present invention uses genetic engineering technology to induce the expression of fusion protein HABP-mKate, which solves the shortcomings of the prior art

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Fusion protein HABP-mKate and preparation method and application thereof
  • Fusion protein HABP-mKate and preparation method and application thereof
  • Fusion protein HABP-mKate and preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0022] Preparation of embodiment one fusion protein HABP-mKate

[0023] 1. Gene optimization and synthesis

[0024] Link the amino acid sequences of HABP and mKate, and add a linker in the middle (see figure 2 ), and then input the linked HABP-mKate amino acid sequence (SEQ ID NO.2) into the IDT gene optimization software (http: / / www.idtdna.com / ) for codon bias analysis (Escherichia coli) , select commonly used codons in the Escherichia coli expression system, optimize the amino acid sequence, and obtain the gene sequence (SEQ ID NO.1) corresponding to the amino acid sequence of HABP-mKate. The gene sequence is input into gene2oligo (http: / / berry.engin.umich.edu / gene2oligo / ) to obtain the corresponding Oligo, and these Oligo are synthesized in vitro by overlapping PCR method. HABP-mKate fusion gene, in the HABP-mKate fusion gene Select and design PCR primers on both sides, and synthesize two by chemical synthesis, respectively:

[0025]P1: TTCATATGGGTGTTTATCACCGCG (5-primer...

Embodiment 2

[0034] 1. Analysis of the binding ability of fusion protein HABP-mKate to HA

[0035] In order to detect the specific binding ability of the fusion protein HABP-mKate to HA, we coated the HA protein (Sigma, St Louis, MO) at a concentration of 1 mg / ml on a microwell plate overnight at room temperature, and then used After washing three times with PBS, they were blocked with 0.5% casein for 2 hours at room temperature. At this time, we added HABP-mKate (0.05-10ug / ml) prepared in Example 1, HABP-mKate and free low molecular weight HA (HA24) (from sigma company) and blank to the above holes respectively. For comparison, the result is Figure 5 , only HABP-mKate has an OD650 as high as 0.45, but when there is HA24 or the blank control, the OD650 only reaches about 0.1, indicating that the fusion protein HABP-mKate has a specific binding ability to HA.

[0036] 2. Analysis of the binding ability of fusion protein HABP-mKate to 4T1 cells specifically expressing HA

[0037] In orde...

Embodiment 3

[0045] Fluorescent Stability Test of Embodiment 3 HABP-mKate

[0046] In order to judge the feasibility of HABP-mKate as a reagent for detecting HA, the fluorescence stability of HABP-mKate must be tested as follows:

[0047] 1. Shake 1000ml of bacteria containing the HABP-mKate gene first, induce expression with 0.1M IPTG overnight at room temperature, suspend the collected bacteria in PBS, centrifuge after ultrasonic crushing to obtain the supernatant, and then filter the supernatant through a 0.45um filter. The resulting supernatant was purified by a nickel ion column, washed with PBS / 0.005M imidazole, eluted with PBS / 0.5M imidazole, and the protein concentration (OD280nm) was measured after dialysis (PBS, 10Kda membrane) after the elution, which was 0.2mg / ml

[0048] 2. Dilute HABP-mKate with a concentration of 0.2 mg / ml to a final concentration of 10 μg / m with PBS, take 100 μl and put it on a 96-well plate, and read the fluorescence value with a 96-well fluorescence pla...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a fusion protein HABP-mKate and a preparation method and application thereof. The fusion protein HABP-mKate has the amino acid sequence disclosed as SEQ ID NO.2. The fusion protein HABP-mKate is prepared as follows: optimizing the gene sequence of HABP and mKate by gene optimization software; synthesizing the optimized gene sequence in vitro with an overlapping PCR method; adding a corresponding endonuclease site on two ends; cloning to a PET-15b expression vector; converting BL21-plus host bacteria; carrying out induction expression; separating expression bacteria after ultrasonication to obtain supernatant; filtering the supernatant obtained by separation by a filter membrane; carrying out affinity purification by a nickel post; eluting by 0.5M imidazole buffer solution; and obtaining the target protein HABP-mKate. The fusion protein HABP-mKate is used for detecting hyaluronic acid.

Description

technical field [0001] The invention belongs to the field of genetic engineering and relates to a fusion protein HABP-mKate and its preparation method and application. It involves producing soluble fusion protein HABP-mKate in Escherichia coli by means of molecular cloning and gene optimization. In addition, it involves how to synthesize an optimized gene sequence and how to introduce the synthesized gene sequence into an expression vector. In addition, it also relates to a method for soluble expression of HABP-mKate protein in Escherichia coli transformed with fusion protein HABP-mKate gene, and how to purify hyaluronic acid binding protein from bacterial soluble supernatant. In addition, it also relates to a method for identifying the specific adsorption of HABP-mKate to cells and living tissues expressing HA. technical background [0002] Hyaluronan, also known as hyaluronic acid (HA), is a natural linear polymer that plays an important role in maintaining the moisture ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07K19/00C12N15/62C12N15/70G01N33/68G01N21/64
Inventor曹利民
Owner曹利民