Tobacco genome molecular marker probe and sequence collective group as well as acquiring method and application thereof

A genome sequence and molecular marker technology, applied in the fields of biotechnology and genetic engineering, tobacco gene research and application, can solve problems such as inability to identify heterozygotes and homozygotes, affecting the genetic basis and laws of tobacco, and low genetic diversity

Active Publication Date: 2012-10-31
YUNNAN ACAD OF TOBACCO AGRI SCI
View PDF1 Cites 19 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Although my country has done a lot of research work on tobacco germplasm resources, due to the limitation of technical means and the low genetic diversity among tobacco varieties, a high-density genetic map covering the entire genome has not yet been built. , which has seriously affected the research on the genetic basis and genetic laws of important agronomic traits in tobacco
At present, most of the molecular markers used in tobacco are RAPD markers. Although the detection technology is simple, it has poor reproducibility, low reliability and cannot distinguish heterozygotes and homozygotes.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Tobacco genome molecular marker probe and sequence collective group as well as acquiring method and application thereof
  • Tobacco genome molecular marker probe and sequence collective group as well as acquiring method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0035](1) Collect 24 tobacco cultivation samples, namely MSK326, MS Yunyan 85, MS Yunyan 87, Hongda, K346, V2, Yunyan 201, Yunyan 202, Yunyan 203, Yunyan 97, Yunyan 98, China Tobacco 100, PVH19, Yunyan 96, Yunyan 99, Yunyan 100, Yunyan 108, Yunyan 105, KRK26, YHO5, NC102, NC97, XYN87 and KRK28. Extract deoxyribonucleic acid (gDNA) from each sample.

[0036] (2) Treat each gDNA sample with a six-base restriction endonuclease PstI, add 500 ng gDNA samples to each 50 μL enzyme digestion reaction system, and add 30 units of restriction endonuclease PstI at 37 Digest the gDNA sample at ℃ for 3 hours.

[0037] (3) The digested gDNA sample was precipitated with isopropanol, then ligated with 1 × ligation buffer, 10 units of ligase and 50 ng of Pst I linker at 16°C for 45 minutes, with a total reaction volume of 30 μL.

[0038] (4) The Pst I linker sequence is as follows:

[0039] 5'-GTACATATTGTCGTTAGAACGCGTAATACGACTCACTATAGGGAGACTG-3'

[0040] 3'-CATGTATAACAGCAATCTTGCGCATTATGCTGA...

Embodiment 2

[0052] (1) A tobacco line (K326) was selected as the starting material. In order to keep its genetic background consistent, only a young leaf of a single plant was taken for tissue culture.

[0053] (2) The specific procedure is that after the leaves are divided into eight equal parts, each part of the leaves is individually cultured into seedlings.

[0054] (3) After 3 months of tissue culture on the young leaves of tobacco K326 above, the genomic gDNA was extracted from a single tissue culture plantlet in each bottle and stored in a -20°C refrigerator for subsequent genetic stabilization of tobacco MITE elements Sexual analysis experiments.

[0055] (4) Using the №:13 sequence in the sequence list as a template, a set of nested PCR primer combinations can be designed and completed, and its detailed sequence is as follows:

[0056] T9P1A Primer: 5'- GTGTCAACCGACACTCCTTCGTAGG -3'

[0057] T9P2A Primer: 5'- TGACACCCCTTGACTTCTTGGTGAG -3'

[0058] (5) Firstly, the first round ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a tobacco genome molecular marker probe and sequence collective group as well as an acquiring method and an application thereof. The probe and primer set has any nucleotide sequence as shown in all or partial No9-25. The new probe and primer sequence sets are from a series of new minitype reverse repetitive transposable elements separated and identified by the inventor of the invention. The probe and primer are acquired through a sequence group and independent sequence and through new sequence selection and identification, and can be applied to the following fields: 1, tobacco molecular marker auxiliary breeding, and selecting and breeding of new breeds of traditional tobacco to fasten the process; 2, construction of tobacco genetic spectrum and identification of tobacco DNA fingerprint; 3, important functional gene positioning and cloning in tobacco genome; 4, early-stage identification and selection of important agronomic character of tobacco; 5, genetic relationship identification of different tobacco breeds or strain materials; and 6, true-false identification of tobacco products (including cigarettes).

Description

technical field [0001] The invention belongs to the technical field of biotechnology and genetic engineering, further belongs to the technical field of tobacco gene research and application, and specifically relates to a collection of tobacco genome molecular probes and sequences, an acquisition method and application. Background technique [0002] Tobacco (Nicotiana tabacum) belongs to the genus Nicotiana of the family Solanaceae and is an annual herb. For the development of botanical science, whether it is basic research or applied research, tobacco has played a great role as a model plant, such as tobacco transgenic research, tobacco beneficial gene molecular markers, etc. Although my country has done a lot of research work on tobacco germplasm resources, due to the limitation of technical means and the low genetic diversity among tobacco varieties, a high-density genetic map covering the entire genome has not yet been built. , which has seriously affected the research o...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/11C12N15/10C12Q1/68
Inventor李文正刘勇王丙武张家瑞顾华国邵岩
OwnerYUNNAN ACAD OF TOBACCO AGRI SCI