Check patentability & draft patents in minutes with Patsnap Eureka AI!

rgd-recombinant staphylokinase-human alpha microglobulin fusion protein and its preparation and application

A technology of fusion protein and microglobulin, which is applied in the field of genetic engineering, can solve the problems such as the decrease of RGD-recombinant staphylokinase activity, and achieve the effect of maintaining thrombolytic activity, good anticoagulant activity, and high-efficiency expression

Inactive Publication Date: 2018-03-02
CHONGQING MEDICAL UNIVERSITY
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At the same time, the fusion protein of the present invention also overcomes the shortcomings of some existing RGD-recombinant staphylokinase activity decline and insoluble expression

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • rgd-recombinant staphylokinase-human alpha microglobulin fusion protein and its preparation and application
  • rgd-recombinant staphylokinase-human alpha microglobulin fusion protein and its preparation and application
  • rgd-recombinant staphylokinase-human alpha microglobulin fusion protein and its preparation and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0065] Embodiment 1 Expression and purification of recombinant staphylokinase

[0066] For the expression and purification method of recombinant staphylokinase (rSAK), please refer to "Expression, Purification and Identification of Fibrinolytic Activity of Recombinant Staphylokinase", Journal of Chongqing Medical University, Vol. Cold, Zhou Jianzhong.

[0067] That is, the main construction methods are as follows:

[0068] Using gene synthesis technology, optimize the synthetic rSAK full-length gene sequence, while keeping the protein sequence unchanged, optimize part of the codon base sequence that may affect the translation and expression process, making it the preferred codon or the best codon for Escherichia coli Codon, using pET-28a as a vector, induced the optimized gene sequence to be expressed in competent E.coli BL21 and purified by Ni-NAT column.

[0069] The rSAK full-length gene sequence is shown in SEQ ID NO.1, specifically:

[0070] TCATTCTCCTCCATTACCAACGAAGTC...

Embodiment 2

[0073] Example 2 Expression and purification of human α-microglobulin fusion protein

[0074] For the expression and purification method of human α-microglobulin (α1M), see Zhang Y, Gao Z, Zhang Z, et al. Cloning, purification, crystallization and preliminary X-ray sstudies of human α1-microglobulin[J].Acta Crystallogr Sect F Stryc Biol Crystal Commun, 2012, 68(pt 6):692-694.

[0075] The gene sequence of the human α-microglobulin (α1M) is shown in SEQ ID NO.3, specifically:

[0076]CAAGTGCAGGAAAACTTCAATATCTCTCGGATCTATGGGAAGTGGTACAACCTGGCCATCGGTTCCACCTGCCCCTGGCTGAAGAAGATCATGGACAGGATGACAGTGAGCACGCTGGTGCTGGGAGAGGGCGCTACAGAGGCGGAGATCAGCATGACCAGCACTCGTTGGCGGAAAGGTGTCTGTGAGGAGACGTCTGGAGCTTATGAGAAAACAGATACTGATGGGAAGTTTCTCTATCACAAATCCAAATGGAACATAACCATGGAGTCCTATGTGGTCCACACCAACTATGATGAGTATGCCATTTTCCTGACCAAGAAATTCAGCCGCCATCATGGACCCACCATTACTGCCAAGCTCTACGGGCGGGCGCCGCAGCTGAGGGAAACTCTCCTGCAGGACTTCAGAGTGGTTGCCCAGGGTGTGGGCATCCCTGAGGACTCCATCTTCACCATGGCTGACCGAGGTGAATGTGTCCCTGGGGAGCAGGAA。

[00...

Embodiment 3

[0079] Example 3 Plasmid construction of RGD-recombinant staphylokinase-human α-microglobulin fusion protein

[0080] 1.1 Materials

[0081] Recombinant staphylokinase (rSAK) was constructed by Example 1, human α-microglobulin truncation (α1M) was constructed by Example 2, and the plasmid vector PEGX6P-1 was purchased from Novagen. Escherichia coli DH5α, BL21, 3C protease, restriction endonuclease NotI, SalI, T4 DNA ligase, high-fidelity rTaq enzyme, dNTP, plasmid purification kit, DNA Marker, molecular weight protein marker, etc. were purchased from Takara Company. Plasmid extraction kits were purchased from Promega. Thrombin, plasminogen, fibrinogen, and urokinase standard products were all purchased from China Food and Drug Control Institute. The rest of the reagents were of domestic analytical grade.

[0082] 1.2 Instruments

[0083] Water bath box, incubator, metal bath connector, PCR instrument, gel imager, ultrasonic breaker, gradient cup, protein concentration dete...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

PropertyMeasurementUnit
molecular weightaaaaaaaaaa
Login to View More

Abstract

The invention provides an RGD-recombinant staphylokinase-human alpha microglobulin fusion protein and its preparation and application. The amino acid sequence of the RGD-recombinant staphylokinase-human α-microglobulin fusion protein of the present invention is shown in SEQ ID NO.12. The fusion protein of the present invention is obtained by the following preparation method: the target gene fusion fragment is obtained by overlapping extension PCR method; the target gene fusion fragment is inserted into the expression vector to construct a recombinant expression plasmid; the constructed recombinant expression plasmid is transformed into Escherichia coli, and in Escherichia coli High-efficiency expression; separation and purification of fusion protein. Compared with existing similar products, the fusion protein of the invention not only has high-efficiency thrombolytic and anticoagulant activity, but also has low immunogenicity. At the same time, the fusion protein of the present invention also overcomes some existing shortcomings of reduced activity and insoluble expression of RGD-recombinant staphylokinase.

Description

technical field [0001] The invention belongs to the technical field of genetic engineering, in particular to RGD-recombinant staphylokinase-human alpha microglobulin fusion protein and its preparation and application. Background technique [0002] Natural staphylokinase (staphylokinase, SAK) is an extracellular protein synthesized by lysogenic phage of Staphylococcus aureus. It consists of 136 amino acid residues and has a molecular weight of 15.5KD. Staphylokinase, endogenous tissue plasminogen activator (tPA) and urokinase (UK) are both third-generation thrombolytic preparations, and are the first-line drug for clinical thrombolytic therapy of myocardial infarction. The thrombolytic mechanism is different from the other two: it has no protease activity itself, and is an "indirect" plasminogen activator, which is produced by specifically combining with plasminogen (Flg) at a ratio of 1:1 The inactive SAK-Flg complex is further converted into an active SAK-Flm complex under...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N9/12C12N15/54C12N15/63A61K38/45A61K38/17A61K48/00A61P7/02
Inventor 周建中汪德强苟冶然龙小滨陈检杨可白垒雷寒黄爱龙何泉张宏鹏
Owner CHONGQING MEDICAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More