A Recombinant Escherichia coli and Its Application in Fermentative Production of 2[4fe4s]ferredoxin

A technology for recombinant Escherichia coli, protein, applied in fermentation, microorganism-based methods, bacteria and other directions, can solve the problems of high protein price, low activity, low expression, etc., and achieve good application prospects, increased yield, and high expression. Effect

Inactive Publication Date: 2019-05-21
INST OF BASIC MEDICINE OF SAMS
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, only the [2Fe2S] type ferredoxin from spinach is commercially sold. However, due to species differences, this ferredoxin shows different efficiencies when analyzing enzymes from other species, and the protein is very expensive , which largely limits the application of ferredoxin and scientists' research on ferredoxin-related enzymes and metabolic processes
[0003] In the existing literature reports, most ferredoxins are purified from wild bacteria and other organisms, and are also prepared by heterologous expression, but these methods have many shortcomings, such as consuming a lot of time and cumbersome purification steps , low expression, incomplete iron-sulfur cluster assembly of ferredoxin and low activity, low final yield and purity, etc.
Based on this, the research and development of a method capable of efficiently expressing 2[4Fe4S]ferredoxin has become an urgent problem to be solved. After searching, the recombinant Escherichia coli capable of efficiently expressing 2[4Fe4S]ferredoxin and its production in fermentation The application of 2[4Fe4S]ferredoxin has not been reported

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A Recombinant Escherichia coli and Its Application in Fermentative Production of 2[4fe4s]ferredoxin
  • A Recombinant Escherichia coli and Its Application in Fermentative Production of 2[4fe4s]ferredoxin
  • A Recombinant Escherichia coli and Its Application in Fermentative Production of 2[4fe4s]ferredoxin

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0034] Example 1: Construction of recombinant Escherichia coli highly expressing 2[4Fe4S]-type ferredoxin in C.pasteurianum DSM 525

[0035] Take C.pasteurianum DSM 525 cells, and extract genomic DNA from C.pasteurianum DSM 525 cells according to the method recommended by the bacterial genomic DNA extraction kit. According to the known 2[4Fe4S]-type ferredoxin gene sequence in the genome of Clostridium pasteurianum (C.pasteurianum) DSM 525 as shown in SEQ ID NO.1, the primers were designed as follows:

[0036]F Primer: 5'GACGACGACAAGATGGCATATAAAATCGCTGATTCATGTG 3'

[0037] R primer: 5'GAGGAGAAGCCCGGTTATTCTTGTACTGGTGCTCCAACTGGA 3'

[0038] Using the extracted C. pasteurianum DSM 525 genomic DNA as a template, KOD hot-start DNA polymerase was used for PCR amplification to obtain 2[4Fe4S]-type ferredoxin gene. The PCR reaction system is as follows:

[0039]

[0040] The PCR reaction conditions are:

[0041] 95℃5min

[0042] 95°C 30s, 55°C 30s, 72°C 30s 30 cycles

[0043]...

Embodiment 2

[0048] Embodiment 2: the application of recombinant escherichia coli highly expressed 2 [4Fe4S] ferredoxin

[0049] (1) Inoculate the recombinant Escherichia coli strain constructed in Example 1 into the TB medium containing antibiotics and iron-sulfur sources with an inoculum size of 1% by volume, and cultivate it at 37°C and 180rpm for 2 to 3 hours to OD 620nm is 0.6, the bacterial liquid is obtained;

[0050] Among them, the formula and final concentration of components of the above-mentioned TB medium are: Tryptone 12g / L, Yeast extract24g / L, Glycerol 4ml / L, KH 2 PO 4 2.3g / L, K 2 HPO 4 12.5g / L;

[0051] The above-mentioned antibiotics are chloramphenicol with a final concentration of 25 μg / ml, tetracycline with a final concentration of 10 μg / ml, and carbenicillin with a final concentration of 25 μg / ml;

[0052] The formula and final concentration of the above-mentioned iron and sulfur sources are: ferric ammonium citrate 0.2-0.3g / L, L-cysteine ​​0.1-0.2g / L, ferric ci...

Embodiment 3

[0056] Example 3: Separation, purification and activity determination of 2[4Fe4S]ferredoxin.

[0057] The purification of protein was carried out in an anaerobic operation box, and all solutions used were degassed and anaerobic treated after boiling.

[0058] Prepare the buffer required for purification: buffer A: Tris-HCl 100mM, NaCl 150mM, DTT 2mM, pH7.5; buffer B: sodium phosphate Tris-HCl 100mM, NaCl 150mM, DTT 2mM, desthiobiotin 2.5mM, pH7. 5; Buffer W: sodium phosphate 50 mM, pH 7.0.

[0059] Acquisition of crude enzyme solution: resuspend the frozen cells prepared in Example 2 with buffer A containing 10% glycerol, and use an ultrasonic disruptor to disrupt the cells. The cell disruption procedure is: working time 6 seconds, intermittent time 6 seconds , power 39%, total crushing time is 50 minutes. After the crushing is completed, centrifuge at 12,000 rpm for 30 minutes, take the supernatant and filter it with a 0.22um pore size filter membrane, and place it on ice a...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a recombinant Escherichia coli. The strain contains a 2[4Fe4S]ferredoxin gene with a nucleotide sequence as shown in SEQ ID NO.1, and is named as Escherichia coli pCodonPlus / pRKISC / pET51b-2[4Fe4S]Fd which is obtained by the steps of connecting the 2[4Fe4S]ferredoxin gene into a pET51b carrier to prepare a recombinant plasmid named as pET51b-2[4Fe4S], and transferring the prepared recombinant plasmid to E.coli C41(DE3) containing pCodonPlus and pRKISC plasmids. The invention also discloses application of the recombinant Escherichia coli to fermentative production of 2[4Fe4S]ferredoxin. Experiments prove that each litre of fermented cultures can be used for generating 3.5mg of purified 2[4Fe4S]ferredoxin, and the yield is far higher than 0.5mg of 2[4Fe4S]ferredoxin purified from wild bacteria, and therefore, the recombinant Escherichia coli disclosed by the invention has a favorable application prospect in industrial production.

Description

technical field [0001] The invention relates to gene recombination engineering bacteria and its application, in particular to a recombinant Escherichia coli containing 2[4Fe4S]ferredoxin gene and its application in fermentative production of 2[4Fe4S]ferredoxin. Background technique [0002] Ferredoxin is a kind of acidic protein containing iron-sulfur clusters, and the iron-sulfur clusters are mainly divided into [4Fe4S], [2Fe2S], [3Fe4S] and other types. As a common electron carrier, ferredoxin participates in important metabolic processes such as respiration, photosynthesis, and fermentation. At present, only the [2Fe2S] type ferredoxin from spinach is sold commercially. However, due to species differences, this ferredoxin shows different efficiencies when analyzing enzymes from other species, and the protein is very expensive , which largely limits the application of ferredoxin and scientists' research on ferredoxin-related enzymes and metabolic processes. [0003] In t...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N1/21C12P21/02C12R1/19
Inventor黄海燕王书宁胡烈杰许晓群王郡甫栾俊文苏庆红
OwnerINST OF BASIC MEDICINE OF SAMS