Cad96ca gene related to epidermis development of German cockroach, dsrna of the gene, preparation method and application thereof

A German cockroach and epidermis technology, applied in the field of genetic engineering, can solve problems such as difficult to treat and hidden dangers to human health and safety

Active Publication Date: 2020-09-01
SOUTH CHINA NORMAL UNIVERSITY +1
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Cockroaches are widely distributed and are also the most difficult worldwide household hygiene pests, which will bring great safety hazards to human health

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Cad96ca gene related to epidermis development of German cockroach, dsrna of the gene, preparation method and application thereof
  • Cad96ca gene related to epidermis development of German cockroach, dsrna of the gene, preparation method and application thereof
  • Cad96ca gene related to epidermis development of German cockroach, dsrna of the gene, preparation method and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0032] Embodiment 1 of the present invention is: the design and synthesis of dsRNA:

[0033] Total RNA from the fat body of Blattella germanica was extracted using TRIzol (Life Technologies), and then the first strand of cDNA was synthesized by reverse transcription (PrimeScript II reverse transcriptase (Takara Bio, Shiga, Japan)) using OligodT primers.

[0034] According to the existing genome information of the German cockroach, the complete sequence of the Cad96ca gene of the German cockroach was found by comparing with other species, as shown in SEQ ID No.1.

[0035] SEQ ID No. 1:

[0036]ATGATTCGGAACTGGGTCATCCAGGACACGGTTCCCTTGGGAGAAATCGTCGCCAGGGTGAGAGCCGAGGACTCCGAGATGGACAGACTCGTGTACGGGTTGGAACCCAAGTTCAGTGGCGGAGGCGCCTACAACAAGCCCTTGCCCTTCGTCATCAACAACACGACGGGCATCGTCAAGGTCAACGACTCTCTCCTCAACAGGGGCGGCGAGCAGTTCCTCCTGTACGTCACAGTGAGCGACGGAAAACTGACGAGCAAAAACGAAGTTTGGGTGAAGATCGTCAACTCGTCAGCGGACCCCGATTCGTCCAACATCAACAGTGGCGGGCCACCGCTGGGGGCGGCGAGTTTCCTGCCGAAATTCCACTCCCAATACCCTGGGGGCGGCA...

Embodiment 2

[0043] Embodiment two of the present invention is: the application of dsRNA (in vivo experiment of German cockroach):

[0044] In order to verify the influence of the dsRNA targeting the Cad96ca gene prepared by the present invention on the development of the epidermis of the German cockroach, it is implemented by injecting the dsRNA into the German cockroach. CK, which does not target any gene of Blattella germanica, was used as a negative control for dsRNA.

[0045] The steps are as follows: select 5-year-old (N5) and 6-year-old (N6) German cockroaches that have just molted and raise them, place them on the microscope dissecting table after anesthesia at low temperature on the second day after their molting, and then use microinjection Methods The dsRNA targeting the silencing of the Cad96ca gene was injected into the abdomen of the German cockroach at a certain dose, and the injection was performed once in total. After the injection, the effect of dsRNA treatment on the mol...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a Cad96ca gene related to German cockroach epidermal development, dsRNA of the gene and a preparation method and an application thereof. The nucleotide sequence of the Cad96cagene is as shown in SEQ ID No. 1, and the dsRNA is a double-stranded RNA composed of a nucleotide sequence as shown in SEQ ID No. 2 and a nucleotide sequence reversely complementary with the nucleotide sequence as shown in SEQ ID No. 2. A RNAi interference technology is utilized, dsRNA is synthesized to target silence the epidermal development related gene Cad96ca to influence the ecdysis of cockroaches, the purpose of cockroach prevention and control is achieved on the basis of blocking or destroying the ecdysis of cockroaches, and a new molecular target is provided for pest prevention and control.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and in particular relates to a Cad96ca gene related to epidermis development of the German cockroach, a dsRNA of the gene, a preparation method and application thereof. Background technique [0002] Cockroaches prefer humid, warm and dark living places, like to hide in hidden crevices, and their activities are concentrated at night, so it is difficult for humans to eliminate their populations. Cockroaches are widely distributed and are also the most difficult worldwide household hygiene pests, which will bring great safety hazards to human health. [0003] Since the 1940s, chemical pesticides and organic insecticides have demonstrated highly effective insecticidal effects in pest control practices, bringing revolutionary changes to pest control. However, with its long-term and large-scale use, a series of negative problems such as soil degradation, pesticide residues, water source and environm...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/12C12N15/113C12N15/10A01N57/16A01P7/04
CPCA01N57/16C07K14/43563C12N15/113C12N2310/14C12N2330/30
Inventor 任充华李胜赵政
Owner SOUTH CHINA NORMAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products