Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

siRNA designed on basis of periplaneta americana male eperythrozoon reproduction related gene SP28 as well as preparation method and application of siRNA

A kind of American cockroach, gene technology, applied in the field of genetic engineering, can solve problems such as incomplete control of cockroaches, toxicity, ecological environment impact, etc.

Active Publication Date: 2021-04-23
SOUTH CHINA NORMAL UNIVERSITY +1
View PDF6 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

These cockroach medicines have a certain effect on the prevention and control of cockroaches, but they cannot completely control the cockroaches, and the cockroaches broke out again within a period of time, and these medicines often have certain toxicity and have a certain impact on the ecological environment.
With the long-term and large-scale use of cockroaches, drug resistance has emerged, which means that those cockroach-killing drugs are difficult to control cockroaches.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • siRNA designed on basis of periplaneta americana male eperythrozoon reproduction related gene SP28 as well as preparation method and application of siRNA
  • siRNA designed on basis of periplaneta americana male eperythrozoon reproduction related gene SP28 as well as preparation method and application of siRNA
  • siRNA designed on basis of periplaneta americana male eperythrozoon reproduction related gene SP28 as well as preparation method and application of siRNA

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0036] Design and synthesis of embodiment 1siRNA

[0037] The design and synthesis of siRNA includes the following steps:

[0038] (1) Primer design

[0039] According to the existing genome information of Periplaneta americana, the complete sequence of the SP28 gene (as shown in SEQID No.1) was obtained through protein spectrum identification, and the dsRNA design website E-RNAi (https: / / www.dkfz.de / signaling / e -rnai3 / ), copy and paste the open reading frame sequence of the Periplaneta americana SP28 gene into the website, obtain the best dsRNA target sequence by designing parameter screening, and obtain the dsRNA sequence targeting the silenced Periplaneta americana SP28 gene (by SEQ ID shown in No.2). Design primers according to the nucleotide sequence shown in sequence SEQ ID No.2, forward primer SP28-FP: CTGAAAATAGATGCGGAATA (as shown in SEQ ID No.3) and reverse primer SP28-RP: CTCGGTTTGATGCTGACT (as shown in SEQ ID No. 4).

[0040] The Periplaneta americana SP28 gene...

Embodiment 2

[0050] Embodiment 2 siRNA influences on SP28 gene interference

[0051] The newly emerged Periplaneta americana was selected for breeding, divided into experimental group and control group (injected with siCK that could not target any gene of Periplaneta americana), and its CO 2 After anesthesia, 2 μl (500 ng / μl) of siRNA targeting the SP28 gene was then injected into the abdomen of Periplaneta americana using a microinjection method. On the seventh day, the females were mated, and the hatching rate of the females' eggs and the hatching individual number of each egg were counted. Among them, the experimental group and the control group had three biological repetitions, and 15 Periplaneta americana were used in each repetition.

[0052] 1. Validation of siRNA interference effect on SP28 gene

[0053] qPCR primers were designed using primer premier5 primer design software. The primers used in the fluorescent quantitative PCR detection are as follows: GTTCCACGTGATCGACGCTT (SEQ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses siRNA designed based on a periplaneta americana male eperythrozoon reproduction related gene SP28 as well as a preparation method and application of the siRNA. The siRNA is formed by cutting double-stranded RNA consisting of a nucleotide sequence shown as SEQ ID No.2 and a nucleotide sequence reversely complementary with the nucleotide sequence shown as SEQ ID No.2, and the siRNA is introduced into periplaneta americana, so that the expression of the SP28 gene can be remarkably inhibited, further, the hatching rate of female insects and the number of hatched individuals are affected, the number of cockroach offspring is remarkably reduced, the final purpose of pest control is achieved, and a new molecular target is provided for pest control.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and in particular relates to siRNA designed based on the gene SP28 related to male accessory gland reproduction of the American cockroach and its preparation method and application. Background technique [0002] Periplaneta americana (cockroach) is one of the oldest insects on the earth, widely distributed around the world, and is a world-recognized sanitary pest. Cockroaches prefer dark and humid environments, such as kitchens, toilets, warehouses, sewers, basements, etc. to live in groups. As a kind of omnivorous insect, cockroach eats a wide variety of food, including rice, bread, fruit, sweets, cooked food, etc. It not only pollutes food, but also spreads diseases. It is a carrier of various bacteria, viruses and parasites. It has brought great harm to human life and safety. In addition, cockroaches have extremely strong fecundity. A mature female cockroach can lay eggs many times in one ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/113C12N15/70A01N63/60A01P7/04
CPCA01N63/60C12N15/113C12N15/70C12N2310/141C12N2330/30
Inventor 李昭昕都二霞李胜
Owner SOUTH CHINA NORMAL UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com