siRNA designed on basis of periplaneta americana male eperythrozoon reproduction related gene SP28 as well as preparation method and application of siRNA
A kind of American cockroach, gene technology, applied in the field of genetic engineering, can solve problems such as incomplete control of cockroaches, toxicity, ecological environment impact, etc.
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0036] Design and synthesis of embodiment 1siRNA
[0037] The design and synthesis of siRNA includes the following steps:
[0038] (1) Primer design
[0039] According to the existing genome information of Periplaneta americana, the complete sequence of the SP28 gene (as shown in SEQID No.1) was obtained through protein spectrum identification, and the dsRNA design website E-RNAi (https: / / www.dkfz.de / signaling / e -rnai3 / ), copy and paste the open reading frame sequence of the Periplaneta americana SP28 gene into the website, obtain the best dsRNA target sequence by designing parameter screening, and obtain the dsRNA sequence targeting the silenced Periplaneta americana SP28 gene (by SEQ ID shown in No.2). Design primers according to the nucleotide sequence shown in sequence SEQ ID No.2, forward primer SP28-FP: CTGAAAATAGATGCGGAATA (as shown in SEQ ID No.3) and reverse primer SP28-RP: CTCGGTTTGATGCTGACT (as shown in SEQ ID No. 4).
[0040] The Periplaneta americana SP28 gene...
Embodiment 2
[0050] Embodiment 2 siRNA influences on SP28 gene interference
[0051] The newly emerged Periplaneta americana was selected for breeding, divided into experimental group and control group (injected with siCK that could not target any gene of Periplaneta americana), and its CO 2 After anesthesia, 2 μl (500 ng / μl) of siRNA targeting the SP28 gene was then injected into the abdomen of Periplaneta americana using a microinjection method. On the seventh day, the females were mated, and the hatching rate of the females' eggs and the hatching individual number of each egg were counted. Among them, the experimental group and the control group had three biological repetitions, and 15 Periplaneta americana were used in each repetition.
[0052] 1. Validation of siRNA interference effect on SP28 gene
[0053] qPCR primers were designed using primer premier5 primer design software. The primers used in the fluorescent quantitative PCR detection are as follows: GTTCCACGTGATCGACGCTT (SEQ...
PUM
Login to View More Abstract
Description
Claims
Application Information
Login to View More 


