Unlock instant, AI-driven research and patent intelligence for your innovation.

CpG-ODN with specific immunostimulation effect on PRRSV (porcine reproductive and respiratory syndrome virus) and application of CpG-ODN

An immunostimulating and specific technology, applied in the field of CpG-ODN, can solve problems such as unresearched, and achieve the effects of improving survival rate and breeding efficiency, improving immune response induction and reducing production costs.

Active Publication Date: 2021-02-26
KUNMING INST OF ZOOLOGY CHINESE ACAD OF SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the relationship between the immunostimulatory intensity of the DNA sequence with -GTCGTT- as the CpG motif and the number of -GTCGTT- motifs has not been studied

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CpG-ODN with specific immunostimulation effect on PRRSV (porcine reproductive and respiratory syndrome virus) and application of CpG-ODN
  • CpG-ODN with specific immunostimulation effect on PRRSV (porcine reproductive and respiratory syndrome virus) and application of CpG-ODN
  • CpG-ODN with specific immunostimulation effect on PRRSV (porcine reproductive and respiratory syndrome virus) and application of CpG-ODN

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0027] 1. Screening of specific CpG-ODN fragments

[0028] Screening method: According to conventional techniques, CpG-ODN fragments were directional screened, and the results are shown in Table 1 below.

[0029] Table 1 CpG-ODN fragments screened

[0030]

[0031] The CpG-ODN fragments screened above are screened based on the research of related sequences by relevant personnel, for example:

[0032]References for C274 are "Marshall, J.D., Higgins, D., Abbate, C., et al. (2004). Polymyxin B enhances ISS-mediated immune responses across multiple species. Cellular Immunology, 229, 93–105." and "Teleshova , N., Kenney, J., Williams, V., et al. (2006). CpG-C ISS-ODN activation of blood-derived B cells from healthy and chronic immunodeficiency virus-infected macaques. Journal of Leukocyte Biology, 79, 257–267.” .

[0033] BCG-A4a reference is "Yamamoto, S., Yamamoto, T., Nojima, Y., et al. (2002). Discovery of immunostimulatory CpG-DNA and its application to tuberculosis vacc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of bioengineering, in particular to a CpG-ODN with a specific immunostimulation effect on PRRSV (porcine reproductive and respiratory syndrome virus) and application of the CpG-ODN. The nucleotide sequence of the CpG-ODN is shown as SEQ ID NO:1. Eleven CpG-ODN fragments are screened out, the screened eleven CpG-ODN fragments are connected end to end toform an immune activating unit containing multiple DNA sequences with -CG-dinucleotide as one CpG element, and the immune activating unit is named as Multi-CpG. the DNA sequence TCGTCGTTTTGTCGTTTTGTCGTTTTGTCGTTTTGTCGTT with -GTCGTT- as a CpG element is used to replace one section of DNA sequence with the same length in Multi-CpG, and the DNA sequence is named as Multi-CpG-Mix. A plurality of Multi-CpG-Mix are connected end to end to form a DNA sequence of a CpG element, then the DNA sequence of the CpG element is inserted into a multi-copy cloning vector Puc19 derived vector FVX through two restriction enzyme cutting sites of XbaI and EcoRI, recombinant plasmids FVX-CpG containing a plurality of Multi-CpG-Mix are constructed respectively by means of gene synthesis, then test screening is carried out to obtain CpG-ODN, the innate immunity function in a pig body can be induced to be activated, and the acquired immune function of the PRRSV in the pig body can also be activated.

Description

technical field [0001] The invention relates to the technical field of bioengineering, in particular to a CpG-ODN with specific immunostimulatory effect on PRRSV and its application. Background technique [0002] Porcine Reproductive and Respiratory Syndrome Virus (PRRSV) is the causative agent of Porcine Reproductive and Respiratory Syndrome (PRRS). PRRSV was first discovered in the United States in 1987. In 1991, the Dutchman Wensvoot isolated the virus from sick piglets and sows for the first time, and then Germany, the United States, and the United Kingdom also isolated the virus. At present, the virus has spread throughout North America and Europe, and has spread globally, and epidemic infections have occurred successively in various places, causing serious economic losses to the pig industry. Although porcine reproductive and respiratory syndrome virus vaccines have been widely used, they are accompanied by side effects and have only partial immune protection, which m...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/117C12N15/85A61K31/711A61P31/14
CPCA61K31/711A61P31/14C12N15/117C12N15/85
Inventor 冯璥李涛何文彬吕雪梅
Owner KUNMING INST OF ZOOLOGY CHINESE ACAD OF SCI
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More