Unlock instant, AI-driven research and patent intelligence for your innovation.

A kind of cpg-odn with specific immunostimulatory effect on prrsv and application thereof

An immunostimulatory and specific technology, applied in the field of CpG-ODN, can solve problems such as unresearched, and achieve the effects of improving survival rate and breeding efficiency, reducing pig breeding costs and reducing morbidity.

Active Publication Date: 2021-06-15
KUNMING INST OF ZOOLOGY CHINESE ACAD OF SCI
View PDF4 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the relationship between the immunostimulatory intensity of the DNA sequence with -GTCGTT- as the CpG motif and the number of -GTCGTT- motifs has not been studied

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of cpg-odn with specific immunostimulatory effect on prrsv and application thereof
  • A kind of cpg-odn with specific immunostimulatory effect on prrsv and application thereof
  • A kind of cpg-odn with specific immunostimulatory effect on prrsv and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment

[0027] 1. Screening of specific CpG-ODN fragments

[0028] Screening method: According to conventional techniques, CpG-ODN fragments were directional screened, and the results are shown in Table 1 below.

[0029] Table 1 Screened CpG-ODN fragments

[0030]

[0031] The CpG-ODN fragments screened above are screened based on the research of related sequences by relevant personnel, for example:

[0032]References for C274 are "Marshall, J.D., Higgins, D., Abbate, C., et al. (2004). Polymyxin B enhances ISS-mediated immune responses across multiple species. Cellular Immunology, 229, 93–105." and "Teleshova , N., Kenney, J., Williams, V., et al. (2006). CpG-C ISS-ODN activation of blood-derived B cells from healthy and chronic immunodeficiency virus-infected macaques. Journal of Leukocyte Biology, 79, 257–267.” .

[0033] BCG-A4a reference is "Yamamoto, S., Yamamoto, T., Nojima, Y., et al. (2002). Discovery of immunostimulatory CpG-DNA and its application to tuberculosis vacc...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the technical field of bioengineering, in particular to a CpG-ODN with a specific immunostimulatory effect on PRRSV and its application. The nucleotide sequence is shown in SEQ ID NO:1. Eleven CpG-ODN fragments were screened out, and the screened 11 CpG-ODN fragments were connected end to end to form a DNA sequence containing many CpG-dinucleotides as a CpG motif, named "Multi-CpG" . The DNA sequence with ‑GTCGTT‑ as a CpG motif: TCGTCGTTTTGTCGTTTTGTCGTTTTGTCGTTTTGTCGTT is replaced with a DNA sequence of the same length in the above "Multi‑CpG" and named as "Multi‑CpG‑Mix". Multiple "Multi-CpG-Mix" are connected end to end to form a DNA sequence of a CpG motif, and then the DNA sequence of the CpG motif is inserted into the multi-copy cloning vector Puc19-derived vector FVX through XbaI and EcoRI restriction sites , constructing recombinant plasmids FVX-CpG containing many "Multi-CpG-Mix" by means of gene synthesis, and then screened through experiments, which can not only induce the activation of natural immune function in pigs, but also activate the acquisition of PRRSV in pigs Sexual immune function.

Description

technical field [0001] The invention relates to the technical field of bioengineering, in particular to a CpG-ODN with specific immunostimulatory effect on PRRSV and its application. Background technique [0002] Porcine reproductive and respiratory syndrome virus (PRRSV) is the pathogenic factor of porcine reproductive and respiratory syndrome (PRRS), and it is a new RNA virus infectious disease virus that causes reproductive disorders in sows, respiratory symptoms and high mortality in newborn piglets. PRRSV was first discovered in the United States in 1987. In 1991, the Dutchman Wensvoot isolated the virus from sick piglets and sows for the first time, and then Germany, the United States, and the United Kingdom also isolated the virus. At present, the virus has spread throughout North America and Europe, and has spread globally, and epidemic infections have occurred successively in various places, causing serious economic losses to the pig industry. Although porcine repr...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/117C12N15/85A61K31/711A61P31/14
CPCA61K31/711A61P31/14C12N15/117C12N15/85
Inventor 冯璥李涛何文彬吕雪梅
Owner KUNMING INST OF ZOOLOGY CHINESE ACAD OF SCI