Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A kind of shRNA that inhibits the expression of hsa_circ_0001610 and its expression vector

A carrier and DNA sequence technology, applied in the field of molecular biology, can solve the problems of limited target sequence, shRNA knockdown efficiency, target gene expression before and after knockdown, etc.

Active Publication Date: 2022-07-05
WEST CHINA HOSPITAL SICHUAN UNIV
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, it is difficult to design shRNA for circRNA, and its target sequence must span the circularization site, and the available target sequences are very limited, often resulting in shRNA knockdown efficiency (knockdown efficiency = expression of target gene before and after knockdown The difference in the amount / the expression amount of the target gene before knockdown, the same below) is not enough
There is no report about using shRNA to knock down hsa_circ_0001610

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of shRNA that inhibits the expression of hsa_circ_0001610 and its expression vector
  • A kind of shRNA that inhibits the expression of hsa_circ_0001610 and its expression vector
  • A kind of shRNA that inhibits the expression of hsa_circ_0001610 and its expression vector

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0029] Example 1 Construction of shRNA expression vector

[0030] The circular RNA information is as follows:

[0031] Name: hsa_circ_0001610

[0032] Coordinates: chr6: 47251673-47254331

[0033] Genbank ID: NM_014452

[0034] Length: 1147nt

[0035] Sequence (SEQ ID NO. 1):

[0036]

[0037] Prepare the shRNA expression vector according to the following steps.

[0038] 1. Oligonucleotide Preparation

[0039] According to the circularization site, primers are designed manually as follows:

[0040] Forward primer (Primer F, SEQ ID NO. 2): CCGG GCCATGCTTGGATTCCTTA CTCGAGTAAGGAATCCAAGCATGGCTTTTT

[0041] Reverse primer (Primer R, SEQ ID NO. 3): AATTAAAAAGCCATGCTTGGATTCCTTACTCGAGTAAGGAATCCAAGCATGGC

[0042] The underlined part (SEQ ID NO. 4) is the target sequence, that is, the part identical to the hsa_circ_0001610 sequence, and the second GC (bold in italics) of this part is the cyclization site.

[0043] The primers were formulated according to the following syst...

Embodiment 2

[0073] Example 2 pLKO.1 sh-0001610 knockdown efficiency verification

[0074] The pLKO.1 sh-0001610 was transferred into A549 cells and RKO cells, respectively, and the expression level of hsa_circ_0001610 (ie, CircTNFRSF21) was detected by qPCR. A vector carrying random sequences (sh-scramble) was used as a control and was also transformed into A549 cells and RKO cells, respectively.

[0075] It can be seen that the expression of hsa_circ_0001610 in the cells transformed into pLKO.1 sh-0001610 is much lower than that of the cells transformed into sh-scramble ( image 3 )

[0076] The results showed that hsa_circ_0001610 was effectively inhibited by pLKO.1 sh-0001610, and the shRNA and its vector that inhibited hsa_circ_0001610 were successfully constructed in the present invention.

[0077] In conclusion, the shRNA and its vector of the present invention can efficiently inhibit the expression of hsa_circ_0001610.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a shRNA for inhibiting the expression of hsa_circ_0001610 and an expression vector thereof, belonging to the field of molecular biology. The shRNA of the present invention has the target sequence shown in SEQ ID NO.4. The expression vector of the present invention comprises DNA whose sequence is shown in SEQ ID NO. 2-3, and can target hsa_circ_0001610 to efficiently inhibit its expression.

Description

technical field [0001] The present invention belongs to the field of molecular biology. Background technique [0002] Circular RNA (circRNA) is a type of RNA with a closed circular structure, which is mainly formed by the circularization of mRNA precursors through "back splicing". Since circRNA does not have the 5' end cap structure and 3' end polyadenylation structure of mRNA, it is resistant to exonuclease degradation and has good stability, so it has great potential as a tumor marker. Studies have shown that circRNAs are involved in the occurrence and development of tumors, tumor stemness, drug resistance, etc., and are new methods and targets for tumor therapy. [0003] Studies have reported that circRNAs mainly participate in their biological functions through the following mechanisms: 1) as a molecular sponge of miRNAs, affecting the expression of target genes regulated by miRNAs; 2) interacting with proteins to achieve regulation of protein functions; 3) encoding fun...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12N15/113C12N15/11C12N15/63C12N1/21
CPCC12N15/1135C12N15/63C12N2310/14Y02A50/30
Inventor 李梦倩
Owner WEST CHINA HOSPITAL SICHUAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com