A kind of circular RNA knockdown method and its application

A circular and protein technology, applied in the field of molecular biology, can solve the problems of low efficiency and off-target when knocking down non-specific target parental RNA and circular RNA, achieving less off-target, high design selectivity, and high knockdown efficiency Effect

Active Publication Date: 2021-06-01
GUANGZHOU GENESEED BIOTECH +1
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0008] Based on the above problems, the purpose of the present invention is to solve the problems of low efficiency, off-target, and non-specific targeting of parental RNA when knocking down circular RNA. The method, which can effectively avoid off-targeting, has less interference with the homeostasis environment, makes the experimental results more authentic and reliable, has high efficiency of specific targeting knockdown, and does not non-specifically target parental genes and other beneficial effects

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A kind of circular RNA knockdown method and its application
  • A kind of circular RNA knockdown method and its application
  • A kind of circular RNA knockdown method and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0052] Embodiment 1 dCas13-HRSP12 vector construction

[0053] 1. PCR amplification of the target fragment

[0054] Using LwaCas13a-91902 plasmid, 293T cell cDNA and PCDH-3xFlag plasmid as templates, respectively amplify the inactive dLwaCas13a partial sequence D1 to 1459bp, the inactivated dLwaCas13a partial sequence D2 to 1735bp, the inactive dLwaCas13a partial sequence and Linker and NES sequence D3 is 418bp, Linker and HRSP12 sequence D4 is 430bp, protein tag 3xFlag sequence D5 is 147bp, the specific sequence is as follows:

[0055] KD131-D1-UnF:GCTGGCTAGCGTTTAAACTTAAGCTTGCCACCATGAAAGTGACCAAGGTCGA

[0056] KD131-mut1-R:CCGTGAGCAATACTAGAGATGGCCTCATCGATATTGGCGAAGAAGTCCTCGATCT

[0057] Amplified size 1459bp;

[0058] KD131-mut1-F:CCATCTCTAGTATTGCTCACGGCATCGTGCATTTCAACCTGGAACTGGAAGGCAAG

[0059] KD131-mut2-R:GTTTGCAATATACAGGTCTTTTCTTCTCCTGCTTCAGTTTCTTCACTTTCT

[0060] The amplification size is 1735bp;

[0061] KD131-mut2-F:GAAGAAAGACCTGTATATTGCAAACTACATCGCTCACTTTAATTATAT...

Embodiment 2

[0105] Embodiment 2 The design of gRNA and the construction of vector

[0106] Taking dLwaCas13a (KDHP-a) as an example, the design of the supporting gRNA and the construction of the vector include the following steps:

[0107] 1. Design of gRNA supporting dLwaCas13a

[0108] The gRNA supporting dLwaCas13a consists of DR plus target sequence, in the form of GATTTAGACTACCCCAAAAACGAAGGGGACTAAAACNNNNNNNNNNNNNNNNNNNNNNNNN, where N is the gRNA sequence.

[0109] The primer design software was used to retrieve the sequences at the circularization sites of circular RNAs circPVT1 and circHIPK3, and parameters such as GC content were calculated. The gRNA target sequences were designed as follows, and the corresponding vectors were named G11-G16 and G21-G27, respectively.

[0110] >gRNA targrt-circPVT1-1(11+11)

[0111] CTGGGCTTGAGGCCTGATCTTT

[0112] Among them, the brackets indicate the number of upstream bases at the cyclization site plus the number of downstream bases, that is, 1...

Embodiment 3

[0186] Example 3 Vector transfection and expression of KDHP protein

[0187] Using Lipofectamine 3000, dLwaCas13a (KDHP-a), dPspCas13b (KDHP-b), dRfxCas13d (KDHP-d) and dPspCas13b-truncated (983aa) (KDHP-bt) vectors were used to transfect 293T cells, and the samples were digested and centrifuged after 48 hours.

[0188] Wash 3 times with pre-cooled PBS, blot the residual liquid as much as possible, add 100 μL of cell lysate containing PMSF, lyse at low temperature for 20 minutes, and transfer the liquid to a 1.5 mL EP tube. Then add 5×Loading buffer (at a ratio of 2:1), boil at 100°C for 10 minutes and perform SDS-PAGE electrophoresis.

[0189] Using PVDF membrane, transfer membrane at 350mA for 80min. Then soak the membrane in blocking solution at 37°C for 1 h; take out the membrane and put it directly into the primary antibody (Flag antibody diluted 3000 times), overnight at 4°C; wash the membrane with PBST, 5min×4 times; transfer the membrane to the secondary antibody ( D...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to the field of molecular biology, in particular to a circular RNA targeted knockdown method and application thereof. The circular RNA knockdown method of the present invention is to use dCas13 protein fusion to express HRSP12, and then use dCas13 and supporting gRNA to specifically target circular RNA, and recruit RNase P / MRP complex through dCas13‑HRSP12 fusion protein to achieve specific targeting of circular RNA Degradation has beneficial effects such as less interference to the homeostasis environment, making the experimental results more authentic and reliable, and having high-efficiency and specific targeting knockdown efficiency.

Description

technical field [0001] The invention belongs to the field of molecular biology, and in particular relates to a circular RNA knockdown method and application thereof. Background technique [0002] Circular RNAs (circular RNAs, circRNAs) are a class of circular RNA molecules mainly composed of more than one exon. They exist in large numbers in eukaryotic cells, and their expression has certain tissue and timing specificity, and is not easily detected by exonucleases. Degradation, more stable than linear RNA. Circular RNA can act as a miRNA sponge to regulate host transcriptional activity, directly translate proteins, affect gene regulation and expression, and play an important role in brain development, Parkinson's disease, Alzheimer's disease and tumorigenesis, and is expected to become a new type of clinical disease. diagnostic markers. [0003] Most circRNAs are produced by back-splicing exons of protein-coding genes (host genes). Because they are back-spliced ​​into a ci...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/113C12N9/22C12N15/867C12N7/01
CPCC07K14/47C07K2319/43C12N7/00C12N9/22C12N15/113C12N15/86C12N2740/15021C12N2740/15043
Inventor刘明李自强王超刘景磊蔡秋杰
OwnerGUANGZHOU GENESEED BIOTECH