Method for identifying Vietnam camellia oleifera, Camellia odorata, Camellia frutescens and common Camellia oleifera

Abstract

The invention relates to a method for identifying Camellia Vietnamese (Camellia Vietnamese), Camellia nobilis (C. osmantha), Camellia frutescens (i.e., Camellia oleifera, C. oleifer var.monosperma) and Camellia oleifera (i.e., Camellia oleifera, C. oleifer). The invention relates to a method for identifying Camellia vietnamese, Camellia nobilis, C. oleifer. According to the method, an amplification primer ycf1-5 and a forward sequence (5 '-3') are adopted, wherein the forward sequence is TGACCTCTTAACCAGTTTTTCCA; and the reverse sequence (5 '-3') is TGGATTATCAAGGGCATTCCGT. The detection kit is used for detecting SNP1, SNP2 and InDel 1. An amplification primer is ZDJ-190, and the forward sequence (5 '-3') of the amplification primer is AAAGAGCGTGGAGGTTCGAG; and the reverse sequence (5 '-3') is GACTGGGTGGTCGAGTCATG and is used for detecting the InDel 2 site. After the amplification product is sequenced, the SNP1 and SNP2 in the product sequence of the camellia fragrant flower germplasm material primer ycf1-5 are shown as' T 'basic groups; if the InDel 1 lacks the TCTTT sequence, the camellia meiocarpa is the camellia meiocarpa. The InDel 2 site is Vietnam camellia oleifera if the'AGTAC 'sequence is deleted, and the InDel 2 site is common camellia oleifera if the'AGTAC' sequence is not deleted. Therefore, the Vietnam camellia oleifera resources, the Camellia odorata resources, the Camellia microcarpa resources and the common Camellia oleifera resources can be effectively detected and identified, and a technical support is provided for classification identification and molecular breeding selection of related Camellia oleifera resources.

Description

technical field [0001] The invention belongs to the technical field of molecular biology and plant molecular breeding, and in particular relates to an identification method for Vietnamese Camellia oleifera, Fragrant Flower Camellia oleifera, Small Fruit Camellia oleifera and common Camellia oleifera. Background technique [0002] Camellia oleifera, together with coconut, olive oil and oil palm, is also known as the world's four major woody oil crops. The unsaturated fatty acid content of tea seed oil of Camellia oleifera can reach about 90%, which is a high-grade health-care edible oil. Camellia oleifera currently has a cultivation area of ​​about 70 million mu in China. Camellia oleifera cultivated in China involves multiple species of Camellia genus, including Camellia oleifera, the main species of Camellia oleifera in the Camellia oleifera group. There are many similarities in the morphology of these four species, especially the morphological identification at the seedl...

AI Technical Summary

Problems solved by technology

All of these have a great impact on the production of camellia oleifera, which is not conducive to the development of China's camellia oleifera industry

At the same time, in Camellia oleifera breeding, accurate identification of parents and early identification of hybrid offspring between different species are often required. However, the similarity in morphology, especially the difficulty in distinguishing seedling morphology, has brought great challenges to Camellia oleifera breeding. big inconvenience

Images