29 results about "Common camellia" patented technology

The invention relates to the technical field of cutting seedling raising, in particular to a cutting seedling raising method for camellia sinensis. According to the method, the cutting slips are soaked in the mixed solution of IBA, NAA and rooting powder GGR with the specific concentration, rooting of the camellia longissima cutting seedlings can be promoted, and therefore the survival rate of cutting propagation of the camellia longissima is increased. The invention also provides a camellia japonica cutting seedling raising method based on the mixed solution. The camellia japonica cutting seedling raising method comprises the following specific steps: obtaining camellia japonica cuttings and cutting the camellia japonica cuttings into scion sections; soaking the scion sections in a rooting solution to obtain cutting slips; cutting the cutting slips; seedling management. According to the method, a simple, convenient, safe and efficient camellia sinensis cutting seedling raising technical system is established through a cutting means, a theoretical basis can be provided for large-scale production of high-quality camellia sinensis seedlings, and experimental materials are also provided for camellia sinensis tissue culture seedling raising.

The utility model relates to the technical field of spray irrigation equipment, and discloses spray irrigation equipment for camellia planting, which comprises a movable vehicle plate, rollers are arranged at the bottom of the movable vehicle plate, a water tank is fixedly mounted at the top of the movable vehicle plate, a water adding port is reserved on the surface of the water tank, and two spray irrigation mechanisms corresponding to the water tank are arranged on the surface of the movable vehicle plate. The sprinkling irrigation mechanism comprises a swing box fixedly installed on the surface of the movable sweeping board, and a swing shaft is arranged at the top of the swing box. According to the utility model, by arranging the swing assembly, the angle of the spray head can be adjusted, the angle of the spray head is opposite to the angle of camellia japonica without moving the whole device, so that the purpose of convenience in use can be achieved, and by arranging the two spray irrigation mechanisms, the whole device is moved between two pieces of camellia japonica, and the angles of the two spray heads are independently adjusted; the requirement for simultaneous spray irrigation operation of two plants of camellia can be met, and when the spray irrigation device is used for camellia cultivated in rows, the spray irrigation processing efficiency can be greatly improved.

The invention provides a cultivation method for increasing the kernel rate of dried small-fruit camellia oleifera, and belongs to the technical field of crop cultivation. The invention provides a cultivation method for improving the dry kernel rate of small-fruit camellia oleifera, which comprises the following steps: carrying out variety configuration by taking a clone camellia oleifera variety as a main cultivated variety and taking a common camellia oleifera variety with high dry kernel rate as a matched cultivated variety; meanwhile, after variety configuration is completed, a fertilization scheme is optimized, and exogenous hormones are sprayed in the critical growth period of the small-fruit camellia oleifera. Through scientific variety configuration, fertilization scheme optimization, exogenous hormone spraying and other cultivation technologies, the dry kernel rate of camellia oleifera is effectively increased. By means of the cultivation method, the dry kernel rate of the small-fruit camellia oleifera can be remarkably increased, the camellia oleifera yield and quality are improved, meanwhile, the method has the advantages of being easy and convenient to operate, low in cost and the like, is easy to apply and popularize in camellia oleifera production areas, and has important significance in promoting sustainable and healthy development of the camellia oleifera industry.

The application discloses a composition for lightening dark circles under eyes containing camellia chrysantha extract and a preparation method and application thereof, and relates to the technical field of cosmetics.The composition comprises component A, component B and component C;the component A comprises andrographis paniculata extract and camellia chrysantha extract;the component B comprises ubiquinone and safflower extract;and the component C is menthol lactate.The andrographis paniculata extract, the camellia chrysantha extract, the ubiquinone, the safflower extract and the menthol lactate are combined to have a synergistic effect; the composition formed by the specific combination of the components can promote blood microcirculation, inhibit microvascular generation, increase epidermal thickness, relieve cell hypoxia and eye fatigue, reduce blood vessel type dark circles, relieve redness and strengthen skin, and is mild and non-irritating to skin, and is suitable for people with sensitive skin.

The present disclosure provides a composition for repairing cellular DNA damage which contains a kaempferol compound extracted from Camellia japonica seed cake, which is discarded after extracting oil from Camellia japonica seed, as an active ingredient, and which is nature-friendly, is safe for human body with few side effects, and can protect damaged DNA or cells from photo-stimulation.

To provide a method capable of producing ellagic acid simply and quickly without requiring complicated steps as conventionally or expensive raw materials.SOLUTION: Young leaves of plants belonging to genus Camellia, family Theaceae, especially Camellia japonica, are subjected to extraction with a solvent comprising at least one selected from water and polar solvents, after which an alkali is added to the resulting extract so as to render it alkaline. Subsequently, the extract is processed at 50°C or above for a predetermined time, thereby enabling production of ellagic acid simply and quickly.SELECTED DRAWING: None

The present invention relates to a cosmetic composition comprising a first antioxidant and a second antioxidant, in which the first antioxidant is a Camellia japonica extract, and a cosmetic composition comprising a cosmetic composition comprising a first antioxidant and a second antioxidant, in which the first antioxidant is a Camellia japonica extract.

The application provides a camellia plant endophytic bacteria, a bacterial agent thereof and an anti-influenza virus A application; the camellia plant endophytic bacteria is Bacillus thuringiensis, which is preserved in the China General Microbiological Culture Collection Center with a preservation number of CGMCC No.32945. The fermentation product of the strain shows good antiviral activity in in vitro and in vivo experiments, can effectively inhibit the replication of influenza virus, and protect infected mice from lethal influenza virus; also shows the effect of regulating immune response, enhances the secretion of IFN-gamma by down-regulating the secretion of pro-inflammatory factors such as IL-6 and IL-10, thereby improving the immune resistance of the body.

The present invention relates to the field of molecular marker technology, and specifically provides a method for identifying Vietnamese camellia, small-fruit camellia and common camellia. The identification method is to use the amplification primer pair provided by the present invention to detect specific SNP sites, and distinguish camellia varieties based on SNP polymorphisms. The amplification primer pair includes a forward primer 5'CCATAAGTGATTGGAAGTAG3' and a reverse primer 5'GAGCCATAACTAACAGACAG3'. The Vietnamese camellia undergoes a base mutation to "A" at the 213th site of the amplified fragment, the small-fruit camellia undergoes a base mutation to "G" at the 213th site of the amplified fragment; and the common camellia undergoes a base mutation to "T" at the 213th site of the amplified fragment. The method of the present invention is simple, fast and accurate, and provides technical support for the classification and identification of relevant camellia resources and molecular breeding selection.

1. Name of the designed product: wall lamp (Camellia japonica). 2. Use of the designed product: indoor lighting. 3. Design points of the designed product: in shape. 4. Picture or photo that best shows the design points: front view. 5. The back of the designed product is not easily visible or invisible during use, so the rear view is omitted.

The present invention relates to a cosmetic composition comprising a camellia callus-derived exosome as an active ingredient for anti-inflammation, antioxidation, whitening, wrinkle reduction, moisturization, skin regeneration, skin barrier improvement, atopic dermatitis alleviation, and skin soothing. The Camellia callus-derived exosomes provided by the present invention have excellent effects as cosmetics for anti-inflammation, antioxidation, whitening, wrinkle reduction, moisturizing, skin barrier alleviation, atopic dermatitis alleviation, and skin soothing or as a pharmaceutical composition for anti-inflammation, atopic dermatitis alleviation, wound healing, and wound healing promotion.

The present invention provides a high-yield molecular marker and breeding method combining the traits of common Camellia oleifera seedlings, belonging to the technical field of gene breeding. The present invention has developed two high-yield molecular markers, ISSR815 and ISSR820, which are closely linked to the traits of one-year-old seedlings cultivated from hybrid seeds of common Camellia oleifera, and obtained four gene loci, 815-6, 815-3, 820-7, and 820-8. Combining the three indexes of seedling height, height-diameter ratio, and water use efficiency of one-year-old seedlings cultivated from hybrid seeds, high-yield excellent families and plants of common Camellia oleifera are selected from 19 hybrid families in the natural population, with a selection efficiency of 75% and a correct rate of 100%. According to this method, high-yield families of common Camellia oleifera are obtained, with high yields. The average yield per unit crown area is 2.91 kg / m 2 , which is much higher than the national industry standard of 1.2 kg / m for the average yield per unit crown area 2 . In each hybrid generation, high-yield varieties can be successfully screened out within two years, greatly shortening the breeding cycle compared with the more than ten or twenty years of the existing technology, and solving the problems of long breeding cycle, poor stability, and low efficiency in the existing Camellia oleifera cross-breeding

A cosmetic composition comprising a first antioxidant agent and a second antioxidant agent, wherein the first antioxidant agent is a Camellia japonica extract.

The invention belongs to the technical field of microorganisms, and discloses candida and application thereof in fermentation of camellia yunnanensis. Candida ralensis BTN-HB-M5 is obtained by separating wild edible fungi (white boletus) in Yunnan, the candidida ralensis BTN-HB-M5 is preserved in Guangdong Microbial Culture Collection Center on September 20, 2024, and the preservation number is GDMCC No: 65164. The camellia yunnanensis fermentation extract can be obtained by utilizing the candida sp. BTN-HB-M5 through proper culture and collection processes, and the whole fermentation process is green and efficient; the prepared camellia japonica fermentation extract is a product fermented only by using Candida railensis, can be used in food and daily chemical products, keeps natural active substances of camellia japonica to the greatest extent, is free of other additional components and irritant by-products, and can be applied to the daily chemical products. The camellia yunnanensis fermentation extract has excellent anti-oxidation, anti-saccharification and anti-aging effects, can obviously relieve skin aging indexes through oxidation resistance, and has a great application prospect in the field of daily chemical products.

The invention relates to the technical field of molecular markers, in particular to three SNP (Single Nucleotide Polymorphism) molecular markers related to the oil content of common camellia oleifera kernels and application of the three SNP molecular markers. The invention provides three SNP (Single Nucleotide Polymorphism) molecular markers Chr03186508315, Chr05105254880 or Chr38117180360 which are highly associated with the oil content of the kernel of the common camellia oleifera, the three SNP molecular markers are respectively positioned at the 186508315 site of the chromosome 3 of the common camellia oleifera, the 105254880 site of the chromosome 5 of the common camellia oleifera and the 117180360 site of the chromosome 38 of the common camellia oleifera, the polymorphic genotypes are respectively T / A, T / G and G / A, and the phenotypic variances of the oil content of 2.82%, 2.44% and 2.74% can be respectively explained. By detecting the SNP molecular marker, identification and auxiliary screening can be carried out in the seedling stage, the production cost is greatly saved, and the selection efficiency is improved.

The invention provides a compound camellia extract electuary, a compound camellia extract beverage and a preparation method thereof, and belongs to the technical field of beverage production. The compound camellia extract electuary is prepared from camellia seed oil, a camellia extract, traditional Chinese medicine components, rice protein hydrolysate and honey according to the mass ratio of (4 to 6) to (0.2 to 0.45) to (0.01 to 0.15) to (0.1 to 0.2) to (2 to 5), the camellia extract comprises at least one of a camellia flower extract and a camellia leaf extract; the traditional Chinese medicine component comprises at least one of fructus lycii, glossy privet fruit, rhodiola rosea, red dates, orange peel, honeysuckle, spina date seed, liquorice, longan, momordica grosvenori and poria cocos. The compound camellia japonica extract electuary and the compound camellia japonica extract beverage provided by the invention are rich in nutrition and easy to absorb by a human body, have the effects of replenishing blood and nourishing qi, regulating the body and improving the immunity, and have color, flavor, taste and dissolution stability.

The application discloses a Camellia japonica SCR0319T2 strain and application thereof. The Camellia japonica SCR0319T2 strain is collected and screened from the wild, and is identified by molecular biology to belong to Flammulina filiformis After subculture, it is found that the Camellia japonica SCR0319T2 strain has excellent stability, can stably grow after more than 30 generations, has a low elimination rate, can be used as an industrial large-scale production strain, and has a fast spawn production speed and a short production cycle. After detection, it is found that the fruiting body has higher contents of vitamin B1 and nicotinic acid than common varieties, is resistant to storage, and has a good taste.

The invention relates to the technical field of molecular markers, in particular to two SNP molecular markers related to the oil content of common camellia oleifera kernels and application of the two SNP molecular markers. The invention develops two SNP molecular markers highly associated with the oil content of common camellia oleifera kernels, and the phenotypic variances of the oil content of 2.75% and 2.20% can be respectively explained. The SNP molecular marker is clear in position, the detection method is convenient and rapid, identification and auxiliary screening can be carried out in the seedling stage, the production and breeding cost is greatly saved, the selection efficiency is improved, the SNP molecular marker is not influenced by the environment, the purposiveness is higher, the workload is small, and the identification accuracy is higher when two SNP molecular markers are jointly used. The method can accelerate the breeding process of common camellia oleifera with high kernel oil content, and has important significance on molecular marker-assisted breeding and genetic improvement of the oil yield of common camellia oleifera.

The invention discloses a method for tissue culture and large-scale propagation of camellia japonica. The method comprises the following steps: obtaining aseptic seedlings of Camellia daurica, carrying out multiplication culture on cluster buds, carrying out single-plant strong seedling culture on adventitious buds, carrying out pre-culture for rooting outside a bottle, and rooting outside the bottle. By optimizing the composition of a cluster bud proliferation culture medium and a seedling strengthening culture medium, proliferation of cluster buds and formation of adventitious buds are promoted, and the proliferation coefficient reaches 8.18; in addition, in-bottle and ex-bottle rooting schemes are combined, the rooting rate and the survival rate are remarkably increased, and the rooting rate reaches 90%. The tissue culture method disclosed by the invention is of great significance in protection and population recovery of the camellia dalbergii, and provides technical support for protection and sustainable utilization of the endangered species.

The invention relates to the technical field of molecular biology, in particular to an SNP molecular marker related to the oil content of common camellia oleifera kernels and application of the SNP molecular marker. The SNP molecular marker is located at a 164424223-site basic group of a No.21 chromosome of common camellia oleifera, and the polymorphism of the basic group is C / T. The SNP molecular marker is clear in position, can explain 3.54% of oil content phenotypic variance, is convenient and rapid in detection method, can perform identification and auxiliary screening in the seedling stage, greatly saves the production and breeding cost, improves the selection efficiency, is not influenced by the environment, and is stronger in purposiveness and small in workload. The method can accelerate the breeding process of common camellia oleifera with high kernel oil content, and has a wide application prospect.

The application discloses a camellia nitidissima gene CpPAL and application thereof in regulating flavonoid content in plant leaves, wherein the nucleotide sequence of the camellia nitidissima gene CpPAL is shown as SEQ ID NO. 1. The application preliminarily predicts the function of the gene based on previous research and bioinformatics analysis software, obtains the full length of the gene sequence through cloning, and constructs an overexpression vector and performs transient transformation on tobacco on this basis. The results show that the flavonoid content in the leaves of the CpPAL transgenic strain is obviously higher than that of the empty carrier. As the gene CpPAL for regulating the flavonoid content in the leaves of camellia nitidissima, the application can be applied to some plants with poor solarization resistance in genetic engineering, and has practical application value.

The invention discloses an ethylene response factor CoERF113 gene of camellia oleifera and application of the ethylene response factor CoERF113 gene. The CDS sequence of the oil tea ethylene response factor CoERF113 gene is shown as SEQ ID NO.1 and SEQ ID NO.2, and the CDS sequence is positioned in a cell nucleus. According to the invention, overexpression of the CoERF113 gene in arabidopsis thaliana can significantly promote senescence of leaves. Instantaneous overexpression of the CoERF113 gene in common camellia oleifera leaves can significantly promote senescence of camellia oleifera leaves, and the CoERF113 gene can be applied to regulation and control of senescence of camellia oleifera organs.

Camellia japonica CjAGL42 gene and application of regulating flowering period of plants, the nucleotide sequence of the Camellia japonica CjAGL42 gene is shown as SEQ ID No. 1, the full-length gene of CjAGL42 of the MADS-box family is cloned from the EMS mutagenesis strain Cj-EMS-79 of Camellia japonica for the first time, and the function of promoting flower bud differentiation and early flowering is determined through heterologous transformation of tobacco, and the problem of low efficiency of flowering period regulation trait improvement in traditional breeding of theaceae ornamental plants is solved.

To provide an AGEs-degrading agent.SOLUTION: A novel AGEs-degrading agent comprises at least one selected from the group consisting of Rosa rugosa cv. Plena extract, N-acetylneuraminic acid, Camellia sinensis (L.) O. Kuntze flower extract, Crocus sativus L. extract, Citrus aurantium L. powder, nicotinamide mononucleotide, Dendrobium officinale Kimura et Migo flower extract, Saccharomyces lysate filtrate, Carboxycarnosine, Camellia japonica seed extract, Bupleurum falcatum extract, and Iris florentina L. root extract.SELECTED DRAWING: None

A new cultivar of Camellia japonica plant named ‘Gordon's Flash’ that is characterized by its variegated foliage with a wide margin of yellow to pale yellow and green centers, its very vigorous growth habit; unique for having variegated foliage, its good early branching, and its peony-formed flowers that are maroon red in color with gold stamens.

1. Name of the designed product: packing bag (wall-hanging type of Camellia japonica toilet paper). 2. Use of the designed product: for packing products. 3. Design points of the designed product: combination of shape and pattern. 4. Picture or photo best showing the design points: perspective view.

The present application relates to a kind of anti-aging protective composition containing camellia japonica extract and application, the liposome composition includes nuclear layer, shell layer and chitosan coating from inside to outside in turn;Wherein, the nuclear layer includes camellia japonica extract and DNA sodium;The shell layer includes lecithin, cholesterol, ceramide and enzymatic tea extract.The present application is wrapped by coating liposome encapsulation technology active substance, help active ingredient penetration skin, from promoting collagen synthesis, enhancing skin elasticity, antioxidant, repair damaged skin barrier etc. multiple dimensions Comprehensive improvement skin aging condition, realize significant anti-aging protective effect.