Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

17 results about "Common camellia" patented technology

Camellia japonica, known as common camellia, Japanese camellia, or Tsubaki in Japanese, is one of the best known species of the genus Camellia. Sometimes called the Rose of Winter, it belongs to the Theaceae family. It is the official state flower of Alabama.

Cultivation method for improving kernel rate of dried small-fruit camellia oleifera

The invention provides a cultivation method for increasing the kernel rate of dried small-fruit camellia oleifera, and belongs to the technical field of crop cultivation. The invention provides a cultivation method for improving the dry kernel rate of small-fruit camellia oleifera, which comprises the following steps: carrying out variety configuration by taking a clone camellia oleifera variety as a main cultivated variety and taking a common camellia oleifera variety with high dry kernel rate as a matched cultivated variety; meanwhile, after variety configuration is completed, a fertilization scheme is optimized, and exogenous hormones are sprayed in the critical growth period of the small-fruit camellia oleifera. Through scientific variety configuration, fertilization scheme optimization, exogenous hormone spraying and other cultivation technologies, the dry kernel rate of camellia oleifera is effectively increased. By means of the cultivation method, the dry kernel rate of the small-fruit camellia oleifera can be remarkably increased, the camellia oleifera yield and quality are improved, meanwhile, the method has the advantages of being easy and convenient to operate, low in cost and the like, is easy to apply and popularize in camellia oleifera production areas, and has important significance in promoting sustainable and healthy development of the camellia oleifera industry.
Owner:FUJIAN ACAD OF FORESTRY

A composition for lightening dark circles under the eyes containing an extract of camellia japonica and a method for preparing and using the same

ActiveCN119745767BCosmetic preparationsToilet preparationsEpidermal thicknessBlood vessel
The application discloses a composition for lightening dark circles under eyes containing camellia chrysantha extract and a preparation method and application thereof, and relates to the technical field of cosmetics.The composition comprises component A, component B and component C;the component A comprises andrographis paniculata extract and camellia chrysantha extract;the component B comprises ubiquinone and safflower extract;and the component C is menthol lactate.The andrographis paniculata extract, the camellia chrysantha extract, the ubiquinone, the safflower extract and the menthol lactate are combined to have a synergistic effect; the composition formed by the specific combination of the components can promote blood microcirculation, inhibit microvascular generation, increase epidermal thickness, relieve cell hypoxia and eye fatigue, reduce blood vessel type dark circles, relieve redness and strengthen skin, and is mild and non-irritating to skin, and is suitable for people with sensitive skin.
Owner:N O D TOPIA (GUANGZHOU) BIOTECHNOLOGY CO LTD

Method for producing ellagic acid from young leaves of plants of genus camellia, family theaceae

PendingJP2025126945AOrganic active ingredientsCosmetic preparationsCommon camelliaTheaceae
To provide a method capable of producing ellagic acid simply and quickly without requiring complicated steps as conventionally or expensive raw materials.SOLUTION: Young leaves of plants belonging to genus Camellia, family Theaceae, especially Camellia japonica, are subjected to extraction with a solvent comprising at least one selected from water and polar solvents, after which an alkali is added to the resulting extract so as to render it alkaline. Subsequently, the extract is processed at 50°C or above for a predetermined time, thereby enabling production of ellagic acid simply and quickly.SELECTED DRAWING: None
Owner:MTG CO LTD

Camellia japonica endophytic bacteria, bacterial agent and anti-influenza a virus application thereof

ActiveCN120041354Blow toxicityeliminate side effectsBacteriaMicroorganism based processesInflammatory factorsImmune resistance
The application provides a camellia plant endophytic bacteria, a bacterial agent thereof and an anti-influenza virus A application; the camellia plant endophytic bacteria is Bacillus thuringiensis, which is preserved in the China General Microbiological Culture Collection Center with a preservation number of CGMCC No.32945. The fermentation product of the strain shows good antiviral activity in in vitro and in vivo experiments, can effectively inhibit the replication of influenza virus, and protect infected mice from lethal influenza virus; also shows the effect of regulating immune response, enhances the secretion of IFN-gamma by down-regulating the secretion of pro-inflammatory factors such as IL-6 and IL-10, thereby improving the immune resistance of the body.
Owner:GUANGXI UNIV

A method for identifying Vietnamese camellia, small-fruit camellia and common camellia

The present invention relates to the field of molecular marker technology, and specifically provides a method for identifying Vietnamese camellia, small-fruit camellia and common camellia. The identification method is to use the amplification primer pair provided by the present invention to detect specific SNP sites, and distinguish camellia varieties based on SNP polymorphisms. The amplification primer pair includes a forward primer 5'CCATAAGTGATTGGAAGTAG3' and a reverse primer 5'GAGCCATAACTAACAGACAG3'. The Vietnamese camellia undergoes a base mutation to "A" at the 213th site of the amplified fragment, the small-fruit camellia undergoes a base mutation to "G" at the 213th site of the amplified fragment; and the common camellia undergoes a base mutation to "T" at the 213th site of the amplified fragment. The method of the present invention is simple, fast and accurate, and provides technical support for the classification and identification of relevant camellia resources and molecular breeding selection.
Owner:SANYA RESEARCH INSTITUTE OF HAINAN ACADEMY OF AGRICULTURAL SCIENCES (HAINAN EXPERIMENTAL ANIMAL RESEARCH CENTER) +1

Wall light (Camellia japonica)

ActiveCN310015524SStructural engineeringCommon camellia
1. Name of the designed product: wall lamp (Camellia japonica). 2. Use of the designed product: indoor lighting. 3. Design points of the designed product: in shape. 4. Picture or photo that best shows the design points: front view. 5. The back of the designed product is not easily visible or invisible during use, so the rear view is omitted.
Owner:伍小明

Three SNP (Single Nucleotide Polymorphism) molecular markers related to oil content of common camellia oleifera seed kernel and application of three SNP molecular markers

The invention relates to the technical field of molecular markers, in particular to three SNP (Single Nucleotide Polymorphism) molecular markers related to the oil content of common camellia oleifera kernels and application of the three SNP molecular markers. The invention provides three SNP (Single Nucleotide Polymorphism) molecular markers Chr03186508315, Chr05105254880 or Chr38117180360 which are highly associated with the oil content of the kernel of the common camellia oleifera, the three SNP molecular markers are respectively positioned at the 186508315 site of the chromosome 3 of the common camellia oleifera, the 105254880 site of the chromosome 5 of the common camellia oleifera and the 117180360 site of the chromosome 38 of the common camellia oleifera, the polymorphic genotypes are respectively T / A, T / G and G / A, and the phenotypic variances of the oil content of 2.82%, 2.44% and 2.74% can be respectively explained. By detecting the SNP molecular marker, identification and auxiliary screening can be carried out in the seedling stage, the production cost is greatly saved, and the selection efficiency is improved.
Owner:RES INST OF SUBTROPICAL FORESTRY CHINESE ACAD OF FORESTRY

Camellia sinensis scr0319t2 and application thereof

ActiveCN121406464BFungiMicroorganism based processesBiotechnologySubculture (biology)
The application discloses a Camellia japonica SCR0319T2 strain and application thereof. The Camellia japonica SCR0319T2 strain is collected and screened from the wild, and is identified by molecular biology to belong to Flammulina filiformis After subculture, it is found that the Camellia japonica SCR0319T2 strain has excellent stability, can stably grow after more than 30 generations, has a low elimination rate, can be used as an industrial large-scale production strain, and has a fast spawn production speed and a short production cycle. After detection, it is found that the fruiting body has higher contents of vitamin B1 and nicotinic acid than common varieties, is resistant to storage, and has a good taste.
Owner:GUANGDONG XIANGQIN BIOLOGICAL TECH CO LTD

Two SNP (Single Nucleotide Polymorphism) molecular markers related to oil content of common camellia oleifera seed kernel and application of two SNP molecular markers

The invention relates to the technical field of molecular markers, in particular to two SNP molecular markers related to the oil content of common camellia oleifera kernels and application of the two SNP molecular markers. The invention develops two SNP molecular markers highly associated with the oil content of common camellia oleifera kernels, and the phenotypic variances of the oil content of 2.75% and 2.20% can be respectively explained. The SNP molecular marker is clear in position, the detection method is convenient and rapid, identification and auxiliary screening can be carried out in the seedling stage, the production and breeding cost is greatly saved, the selection efficiency is improved, the SNP molecular marker is not influenced by the environment, the purposiveness is higher, the workload is small, and the identification accuracy is higher when two SNP molecular markers are jointly used. The method can accelerate the breeding process of common camellia oleifera with high kernel oil content, and has important significance on molecular marker-assisted breeding and genetic improvement of the oil yield of common camellia oleifera.
Owner:RES INST OF SUBTROPICAL FORESTRY CHINESE ACAD OF FORESTRY

Tissue culture and large-scale propagation method of Camellia dalbergii

ActiveCN120937751APlant tissue cultureHorticulture methodsCommon camelliaSeedling
The invention discloses a method for tissue culture and large-scale propagation of camellia japonica. The method comprises the following steps: obtaining aseptic seedlings of Camellia daurica, carrying out multiplication culture on cluster buds, carrying out single-plant strong seedling culture on adventitious buds, carrying out pre-culture for rooting outside a bottle, and rooting outside the bottle. By optimizing the composition of a cluster bud proliferation culture medium and a seedling strengthening culture medium, proliferation of cluster buds and formation of adventitious buds are promoted, and the proliferation coefficient reaches 8.18; in addition, in-bottle and ex-bottle rooting schemes are combined, the rooting rate and the survival rate are remarkably increased, and the rooting rate reaches 90%. The tissue culture method disclosed by the invention is of great significance in protection and population recovery of the camellia dalbergii, and provides technical support for protection and sustainable utilization of the endangered species.
Owner:SOUTH CHINA BOTANICAL GARDEN CHINESE ACADEMY OF SCI

SNP (Single Nucleotide Polymorphism) molecular marker related to oil content of common camellia oleifera seed kernel and application of SNP molecular marker

The invention relates to the technical field of molecular biology, in particular to an SNP molecular marker related to the oil content of common camellia oleifera kernels and application of the SNP molecular marker. The SNP molecular marker is located at a 164424223-site basic group of a No.21 chromosome of common camellia oleifera, and the polymorphism of the basic group is C / T. The SNP molecular marker is clear in position, can explain 3.54% of oil content phenotypic variance, is convenient and rapid in detection method, can perform identification and auxiliary screening in the seedling stage, greatly saves the production and breeding cost, improves the selection efficiency, is not influenced by the environment, and is stronger in purposiveness and small in workload. The method can accelerate the breeding process of common camellia oleifera with high kernel oil content, and has a wide application prospect.
Owner:RES INST OF SUBTROPICAL FORESTRY CHINESE ACAD OF FORESTRY

Camellia japonica gene cpPAL and application thereof in regulating flavonoid content in plant leaves

The application discloses a camellia nitidissima gene CpPAL and application thereof in regulating flavonoid content in plant leaves, wherein the nucleotide sequence of the camellia nitidissima gene CpPAL is shown as SEQ ID NO. 1. The application preliminarily predicts the function of the gene based on previous research and bioinformatics analysis software, obtains the full length of the gene sequence through cloning, and constructs an overexpression vector and performs transient transformation on tobacco on this basis. The results show that the flavonoid content in the leaves of the CpPAL transgenic strain is obviously higher than that of the empty carrier. As the gene CpPAL for regulating the flavonoid content in the leaves of camellia nitidissima, the application can be applied to some plants with poor solarization resistance in genetic engineering, and has practical application value.
Owner:NANJING FORESTRY UNIV

Camellia oleifera abel Cjagl42 gene and application thereof in regulating plant flowering time

Camellia japonica CjAGL42 gene and application of regulating flowering period of plants, the nucleotide sequence of the Camellia japonica CjAGL42 gene is shown as SEQ ID No. 1, the full-length gene of CjAGL42 of the MADS-box family is cloned from the EMS mutagenesis strain Cj-EMS-79 of Camellia japonica for the first time, and the function of promoting flower bud differentiation and early flowering is determined through heterologous transformation of tobacco, and the problem of low efficiency of flowering period regulation trait improvement in traditional breeding of theaceae ornamental plants is solved.
Owner:SOUTHWEST FORESTRY UNIVERSITY

Ages-degrading agent

To provide an AGEs-degrading agent.SOLUTION: A novel AGEs-degrading agent comprises at least one selected from the group consisting of Rosa rugosa cv. Plena extract, N-acetylneuraminic acid, Camellia sinensis (L.) O. Kuntze flower extract, Crocus sativus L. extract, Citrus aurantium L. powder, nicotinamide mononucleotide, Dendrobium officinale Kimura et Migo flower extract, Saccharomyces lysate filtrate, Carboxycarnosine, Camellia japonica seed extract, Bupleurum falcatum extract, and Iris florentina L. root extract.SELECTED DRAWING: None
Owner:SHISEIDO CO LTD

Packaging bag (super point planting camellia wall-mounted toilet paper)

ActiveCN309691745SToilet paperCommon camellia
1. Name of the designed product: packing bag (wall-hanging type of Camellia japonica toilet paper). 2. Use of the designed product: for packing products. 3. Design points of the designed product: combination of shape and pattern. 4. Picture or photo best showing the design points: perspective view.
Owner:CHAODIAN (SHANGHAI) DAILY PROD CO LTD

Anti-aging and repairing composition containing camellia japonica extract and application thereof

The present application relates to a kind of anti-aging protective composition containing camellia japonica extract and application, the liposome composition includes nuclear layer, shell layer and chitosan coating from inside to outside in turn;Wherein, the nuclear layer includes camellia japonica extract and DNA sodium;The shell layer includes lecithin, cholesterol, ceramide and enzymatic tea extract.The present application is wrapped by coating liposome encapsulation technology active substance, help active ingredient penetration skin, from promoting collagen synthesis, enhancing skin elasticity, antioxidant, repair damaged skin barrier etc. multiple dimensions Comprehensive improvement skin aging condition, realize significant anti-aging protective effect.
Owner:N O D TOPIA (GUANGZHOU) BIOTECHNOLOGY CO LTD