Bacillus subtilis and its application in dissolving phosphorus and inhibiting bacteria
A technology of Bacillus subtilis and strains, applied in Bacillus subtilis and its application fields, can solve the problems of different application effects and different soil environment adaptability, and achieve the effects of broad antibacterial spectrum, increasing soluble phosphorus content, and wide application prospects
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Publication Date
- 2022-05-20
Smart Images

Figure 1 
Figure 2 
Figure 3
Abstract
Description
technical field
[0001] The invention belongs to the technical field of microbial fertilizers, and in particular relates to bacillus subtilis and applications thereof. Background technique
[0002] As a large agricultural country, my country's increase in grain production is related to economic development and social stability. The large investment and use of pesticides and fertilizers has played a positive role in improving grain production. However, over the years, due to the excessive dependence on chemical fertilizers, the low utilization efficiency of chemical fertilizers, and the widespread phenomenon of irrational application, this has led to serious soil deterioration, such as compaction, acidification, decline in fertility, micro-ecological imbalance, excessive residues of harmful substances, etc. , has seriously affected the sustainable development of my country's agriculture. In order to improve soil fertility, in 2015 the Ministry of Agriculture of China put forwa...
Examples
Embodiment 1
[0025] Isolation and screening of embodiment 1 phosphorus solubilizing bacterial strain
[0026] The materials for the isolation of phosphorus-dissolving strains were collected from tea gardens in Xinyang where tea trees have been continuously planted for many years, and the root soil of tea trees was selected for the isolation of phosphorus-dissolving strains. Weigh 1g of soil sample into a 2ml test tube, add 1ml of sterile water, mix well, and gradually dilute to 10 -6 . Take 100 μl of the bacterial suspension and spread it on the inorganic phosphorus solid medium ((NH 4 ) 2 SO 4 0.5g, MgSO 4 0.3g, NaCl 0.3g, Ca 3 (PO 4 ) 2 8.0g, glucose 10.0g, 11% MnSO 4 1 mL, 1% FeSO 4 1mL, 21g agarose, add dd H 2 0 to 1L, adjust the pH to 7.2. ) surface layer, cultivated at 37°C for 72 hours, picked a single colony with obvious phosphorus-dissolving circle, and cultured in NA medium by streaking. After the above screening, a bacterial strain WY8-7 capable of degrading ins...
Embodiment 2
[0027] The identification of embodiment 2 phosphate solubilizing strain WY8-7
[0028] (1) Morphological identification of WY8-7
[0029] WY8-7 was streak cultured in NA medium (NA medium: beef extract 3g, peptone 10g, NaCl 5g, agar powder 15g, add ddH 2 (O was fixed to 1L) surface, and observed the colony morphology after 48h. The colonies are milky white with irregular edges, rough surface, opaque, dry and wrinkled and protruding, Gram stain positive, and can form spores (such as figure 2 shown).
[0030] (2) Molecular biological identification of WY8-7
[0031] After WY8-7 was cultured in NB medium for 48 hours, the genomic DNA was extracted using tris-HCl and EDTA extraction methods, and then extracted with phenol-chloroform-isoamyl alcohol (25:24:1). Primers amplified 16S rDNA and sequenced. The length of the sequencing sequence is 1414bp, and the sequence number is SEQ ID NO.1.
[0032] Sequencing primers: 16S rDNA (forward): AGAGTTTGATCCTGGCTCAG, 16S rDNA (revers...
Embodiment 3
[0042] Example 3 Verification of Phosphorus Solubilizing Effect of Bacillus subtilis WY8-7
[0043] (1) Phosphorus-solubilizing effect analysis of strain WY8-7 under liquid shaking culture conditions
[0044] The phosphorus solubilization experiment of strain WY8-7 was carried out in inorganic phosphorus culture solution. After the WY8-7 strain was cultivated in NB medium, the bacteria were collected, washed twice with sterile water, and the concentration was adjusted to 10 8 cfu / mL, inoculated into 40mL inorganic phosphorus liquid culture solution ((NH 4 ) 2 SO 4 0.5g, MgSO 4 0.3g, NaCl 0.3g, Ca 3 (PO 4 ) 2 8.0g, glucose 10.0g, 11% MnSO 4 1 mL, 1% FeSO 4 1 mL, distilled H 2 (0 constant volume 1L, pH 7.2), with the inorganic phosphorus culture solution inoculated with the same amount of sterilized water as a control, each treatment was repeated three times. All treatments were cultured on a shaker at 37°C at 200rpm. 0 , T 3 , T 6 , T 12 , T 20 Samples were...