Constant temperature synchronous amplification detecting process for nucleic acid and use thereof

A detection method and nucleic acid technology, applied in biochemical equipment and methods, microbial measurement/inspection, fluorescence/phosphorescence, etc., can solve the problem of no isothermal amplification and simultaneous detection, etc., achieve fast detection speed, high detection sensitivity, The effect of shortening the time

Active Publication Date: 2008-12-31
SHANGHAI RENDU BIOTECH
View PDF1 Cites 43 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, in the field of nucleic acid diagnosis, there are no related technical rep

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Constant temperature synchronous amplification detecting process for nucleic acid and use thereof
  • Constant temperature synchronous amplification detecting process for nucleic acid and use thereof
  • Constant temperature synchronous amplification detecting process for nucleic acid and use thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0047] Embodiment 1, the detection of bacterial RNA

[0048] Taking the detection of Neisseria gonorrhoeae RNA as an example, bacterial RNA is carried out quantitative detection with the method of the present invention, and specific method comprises the following steps:

[0049] 1. Neisseria gonorrhoeae RNA extraction

[0050] Take the overnight (12-24 hours) culture of Neisseria gonorrhoeae (ATCC NO.19424), and use Trizol kit from Invitrogen Company to extract Neisseria gonorrhoeae RNA.

[0051] 2. Design of Primer 1, Primer 2 and Molecular Beacon

[0052] According to the 16s rRNA sequence of Neisseria gonorrhoeae (LOCUS#X07714, sequence 1 in the sequence listing), a primer 1 with a T7 promoter sequence at the 5' end and a primer 2 without a promoter, as well as a molecular beacon sequence, the sequence is as follows:

[0053] Primer 1: 5'- AATTTAATACGACTCACTATAGGGAGA TCTCAGACCCGCTACTGATCGTCGCCTTG-3' (the underlined base is the T7 promoter sequence, which can be replace...

Embodiment 2

[0063] Embodiment 2, the detection of virus RNA

[0064] Taking the detection of AIDS virus (HIV-1) RNA as example, virus RNA is carried out quantitative detection with the method of the present invention, and concrete method comprises the following steps:

[0065] 1. Acquisition of HIV-1 RNA

[0066] The in vitro transcription product of the purified AIDS (HIV-1) pathogen RNA was provided by RD BioSciences in the United States, and its product manual also provided the content and sequence of the RNA.

[0067] 2. Design of primer 1, primer 2 and fluorescent probe

[0068] According to the in vitro transcription product sequence of the AIDS pathogen (HIV-1) RNA, a 5' end containing a primer 1 of the T7 promoter sequence and a primer 2 without a promoter, as well as the sequence of the fluorescent probe, the sequence is as follows:

[0069] Primer 1: 5'- AATTTAATACGACTCACTATAGGGAGA CCATCTGTTTTCCATAATCCCTAATGATC-3' (the underlined base is the T7 promoter sequence, which can be ...

Embodiment 3

[0079] The detection of embodiment 3, DNA

[0080] Take the detection of hepatitis B (HBV) virus DNA as an example, carry out quantitative detection to DNA with the method of the present invention, concrete method comprises the following steps:

[0081] 1. Obtaining HBV virus DNA

[0082] The plasmid with the cloned HBV virus DNA is provided by RD BioSciences, USA, and its product manual provides the content of the plasmid DNA and the cloned HBV virus DNA sequence (sequence 3 in the sequence listing).

[0083] 2. Design of primer 1, primer 2 and fluorescent probe

[0084] According to the DNA sequence of the HBV virus, a primer 1 with a T7 promoter sequence at the 5' end and a primer 2 without a promoter, as well as the sequence of the fluorescent probe, were designed. The sequences are as follows:

[0085] Primer 1: 5'- AATTTAATACGACTCACTATAGGGAGA CCCACGTGTCCTGGCCAAAATTCGCA-3' (the underlined base is the T7 promoter sequence, which can be replaced by the T3 promoter seque...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a constant temperature synchronous amplified detection method of nucleic acid as well as an application thereof. The method comprises the following steps of: 1) mixing reactants containing the following components: a. a nucleic acid sample under test; b. a primer 1: a 3`-terminal of the primer can be hybridized at a 3`-terminal or near the 3`-terminal of the nucleic acid sample under test, and a 5`-terminal is a promotor sequence; c. a primer 2: the primer can be hybridized with a 5`-terminal of a negative strand of the nucleic acid sample under test; d. one or a plurality of fluorescent probes; e. at least one DNA polymerase relied by RNA; and f. at least one RNA polymerase that can identify the promotor sequence; and 2) carrying out the constant temperature amplification reaction to the mixed reactants in a closed vessel, detecting the changes of fluorescence signals in a reaction system synchronously by a detector, and conducting the quantitative and qualitative detection to the nucleic acid sample according to the time and intensity of fluorescence signal changing. The method and the application have the advantages of low pollution, constant temperature in the reaction process, high detection sensitivity, fast detection speed, low requirements on equipment and instrument and low cost, and are applied to nucleic acid testing in fields such as clinical examination and blood screening.

Description

technical field [0001] The invention relates to a biological detection technology, in particular to a detection method for synchronously performing constant temperature amplification and detection of nucleic acid, and its application in nucleic acid detection in clinical testing, blood screening, food safety inspection and environmental monitoring. Background technique [0002] In the process of nucleic acid detection, in most cases, the content of nucleic acid in the sample is low. In order to achieve a certain sensitivity and accuracy in the detection, it is necessary to amplify the nucleic acid fragments to be detected in the sample. In 1985, the emergence of Polymerase Chain Reaction (PCR) technology promoted the development of nucleic acid detection technology, which has become an important means in nucleic acid detection technology. Subsequently, derivatives such as reverse transcriptase-polymerase chain reaction (Reverse Transcriptase-PCR, RT-PCR for short), real-time...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68G01N21/64
Inventor张常娥
OwnerSHANGHAI RENDU BIOTECH