Novel Ti plasmid pElrLCG for saving plant embryos from lethal mutation and its preparation method

A lethal mutation, plant embryo technology, applied in the field of genetic engineering, can solve the problems of environmental danger, plant toxicity, poor absorption of ecdysone, etc.

Inactive Publication Date: 2009-09-30
HUNAN UNIV
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

The use of tetracycline-inducible carriers is potentially dangerous to the environment. In addition, there must be a large amount of tetracycline in the nucleus to work, and high concentrations of tetracycline are toxic; the disadvantages of estrogen-inducible carriers are: strong local induction, estrogen in It is not easy to spread in the plant, so the whole plant cannot be induced; the main disadvantage of the ecdysone-inducible carrier is: the leaves have poor absorption of the ecdysone; a

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Novel Ti plasmid pElrLCG for saving plant embryos from lethal mutation and its preparation method
  • Novel Ti plasmid pElrLCG for saving plant embryos from lethal mutation and its preparation method
  • Novel Ti plasmid pElrLCG for saving plant embryos from lethal mutation and its preparation method

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0027]1. Digest the pJawoh18-RNAi vector (provided by researcher Fu Yongfu of the Chinese Academy of Agricultural Sciences) with XhoI-SpeI to recover a 5.211kb vector fragment and synthesize a 463bp XhoI-Loxp-NheI-NcoI-Nos-BsiwI-KpnI- StuI-BgIII-MfeI-AatII-1xMyc-Loxp-SpeI fragment, synthesized by Shanghai Sangong, the sequence is as follows:

[0028] CTCGAGGGCGCCGACCTAATAACTTCGTATAGCATACATTATACGAAGTTATCGCT

[0029] AGCCCATGGGAGCTCGAATTTCCCCGATCGTTCAAACATTTGGCAATAAAGTTTC

[0030] TTAAGATTGAATCCTGTTGCCGGTCTTGCGATGATTATCATATAATTTCTGTTGAAT

[0031] TACGTTAAGCATGTAATAATTAACATGTAATGCATGACGTTATTTATGAGATGGGTT

[0032] TTTATGATTAGAGTCCCGCAATTATACATTTAATACGCGATAGAAAACAAAAATATA

[0033] GCGCGCAAACTAGGATAAATTATCGCGCGCGGTGTCATCTATGTTACTAGATCGG

[0034] GAATTCCGTACGGGTACCAGGCCTAGATCTCAATTGGACGTCGAACAGAAGTTAA

[0035] TCAGCGAGGAAGACCTCTGAGACCTAATAACTTCGTATAGCATACATTATACGAA

[0036] GTTATGGCGCCACTAGT

[0037] The synthetic fragment is located at the SmaI site on the vector pUC57 (purch...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The present invention discloses a novel Ti plasmid pElrLCG for saving embryos from lethal mutation and a preparation method of the Ti plasmid pElrLCG. Connect 5.211kb long bearer fragment recovered from enzyme cutting of original bearer pJawoh18 with synthesized XhoI-loxP-NheI-NcoI-Nos-BsiwI-KpnI-StuI-BgIII-MFeI-AatII-1xMyc-loxP-SpeI fragment, and then insert Gr-Cre, Gateway Cassettee fragment between two loxP loca, to construct a new plasmid vector pElrLCG. The plasmid vector can be used to obtain homozygote of embryonic lethal mutant or study the development of homozygote of embryonic lethal mutant in late stage, and therefore is of great significance for study on lethal mutations of embryos, hybridization breeding, and special biologic behaviors of lethal mutants of embryos.

Description

technical field [0001] The invention belongs to the field of genetic engineering, and in particular relates to a novel Ti plasmid for rescuing lethal mutations of plant embryos: pElrLCG and a preparation method thereof. Background technique [0002] The existing inducible vectors that can be used to rescue lethal mutations in plant embryos are: (1) tetracycline-inducible vectors (2) glucocorticoid-inducible vectors (3) estrogen-inducible vectors (4) alcohol-inducible vectors (5) Ecdysone hormone-inducible carrier (6) copper-inducible carrier, etc. The use of tetracycline-inducible carriers is potentially dangerous to the environment. In addition, there must be a large amount of tetracycline in the nucleus to work, and high concentrations of tetracycline are toxic; the disadvantages of estrogen-inducible carriers are: strong local induction, estrogen in It is not easy to spread in the plant, so the whole plant cannot be induced; the main disadvantage of the ecdysone-inducibl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
IPC IPC(8): C12N15/84
Inventor 刘选明王宏归刘萍林辰涛
Owner HUNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap