Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Method for detecting 1494 C-T and 1555 A-G mutation of maternally inherited deafness mitochondrial genes, and kit thereof

A 1494C-T, mitochondrial gene technology, applied in the field of genetic engineering, can solve the problems of inability to achieve rapidity, accuracy, and low cost, and achieve the effects of avoiding drug-induced deafness, strong specificity and high sensitivity

Inactive Publication Date: 2012-02-29
董大光
View PDF1 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This method is simple, quick and low-cost, but it cannot meet the requirements of fast, accurate, low-cost and simultaneous detection of two mutations of 1494C-T and 1555A-G

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for detecting 1494 C-T and 1555 A-G mutation of maternally inherited deafness mitochondrial genes, and kit thereof
  • Method for detecting 1494 C-T and 1555 A-G mutation of maternally inherited deafness mitochondrial genes, and kit thereof
  • Method for detecting 1494 C-T and 1555 A-G mutation of maternally inherited deafness mitochondrial genes, and kit thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0068] Example 1 Detection of the 1494C-T mutation and 1555A-G mutation of the mitochondrial gene in a family with maternally inherited deafness

[0069] 1. Test samples

[0070] Nine deaf families with maternal inheritance as the transmission feature were selected, with a total of 137 people and 30 subjects. Use the column centrifugal blood genomic DNA extraction kit produced by Shanghai Huashun Bioengineering Co., Ltd. to extract peripheral whole blood DNA from the tested individual as a test sample. The comprehensive information of the 9 families is shown in Table 1. pedigree see Figure 5 with Image 6 . The mode of disease transmission in the remaining families was similar.

[0071] 2. Primer design

[0072] Use Genetool Lite and primer premier5.0 programs to assist in the design of primers. According to the published mitochondrial gene Cambridge sequence (Cambridge Sequence), the primer design scheme is as follows:

[0073] (1) The 3' ends of the sequence SEQ ID NO...

Embodiment 2

[0101] Detection of 1494C-T mutation and 1555A-G mutation in mitochondrial gene of maternally inherited deafness using in vitro detection kit

[0102] 1. Kit composition:

[0103] 1. Reagents for extracting DNA from blood samples;

[0104] 2. PCR reagents

[0105] 10mM dNTP0.5ml;

[0106] 10×PCR buffer (containing 15mM Mg 2+ ) 1ml;

[0107] 5U / μl Taq enzyme 2500μl

[0108] 1ml each of the four 10μM primers

[0109] 3. The nucleotide sequences of the four primers are:

[0110] Primer ID NO: 1AAGTGGCTTTAACATATCTG

[0111] Primer ID NO: 2TTGAAGTATACTTGAGCAGA

[0112] Primer ID NO: 3 ACGCATTTATATAGAGCAGG

[0113] Primer ID NO: 4TCAATTTCTATCGCCTATAC

[0114] 4. Positive control sample 100μl, negative control sample 100μl

[0115] Among them: the two positive controls are the PCR amplification products of 1494C-T and 1555A-G mutant genes of mitochondrial DNA respectively, and the negative sample control is the PCR amplification products of normal genes.

[0116] 5. Instr...

Embodiment 3

[0136] Detection of 1494C-T mutation and 1555A-G mutation in mitochondrial gene of maternally inherited deafness using in vitro detection kit

[0137] 1. Kit composition:

[0138] 1. Reagents for extracting DNA from blood samples;

[0139] 2. PCR reagents

[0140] 10mM dNTP0.5ml;

[0141] 10×PCR buffer (containing 15mM Mg 2+ ) 1ml;

[0142] 5U / μl Taq enzyme 2500μl

[0143] 1ml each of the four 10μM primers

[0144] 6. The nucleotide sequences of the four primers are:

[0145] Primer ID NO: 1AAGTGGCTTTAACATATCTG

[0146] Primer ID NO: 5TTGAAGTATACTTGAGCAGG

[0147] Primer ID NO: 6ACGCATTTATATAGAGCAGA

[0148] Primer ID NO: 4TCAATTTCTATCGCCTATAC

[0149] 7. Positive control sample 100μl, negative control sample 100μl

[0150] Among them: the two positive controls are artificially synthesized products of 1494C-T and 1555A-G mutant genes of mitochondrial DNA, and the negative sample control is artificially synthesized products of normal genes.

[0151] 8. Instruction m...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a method for detecting 1494 C-T and 1555 A-G mutation of maternally inherited deafness mitochondrial genes. The method comprises the steps of designing improved primers and detecting 1494 C-T and 1555A-G mutation through Touch-down PCR amplification and agarose gel electrophoresis. The method has the advantages of simplicity, low cost, direct reliable detection result andapplicability to the large-scale screening or preventive examination for the 1494 C-T and 1555 A-G mutation of maternally inherited deafness mitochondrial genes.

Description

Technical field: [0001] The invention relates to the technical field of genetic engineering, in particular to a method for detecting the 1494th position C-T mutation and the 1555th position A-G mutation of the mitochondrial gene of maternally inherited deafness. The present invention also relates to the preparation of a kit for in vitro detection of the 1494 C-T mutation and the 1555 A-G mutation of the mitochondrial gene of maternally inherited deafness according to the method, and the kit can detect the 1494 C-T mutation and the 1555 Application in position A—G mutation. Background technique: [0002] Aminoglycoside antibiotics (streptomycin, gentamycin, kanamycin, tobramycin and micronomycin, etc.) are widely used clinically because of their broad-spectrum and high-efficiency antibacterial effects and low prices. Controls Gram-negative and positive bacterial infections, but these antibiotics have severe ototoxic effects and can cause irreversible hearing loss in patients...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68C12N15/11
Inventor 董大光
Owner 董大光
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com