10results about How to "Highly conservative" patented technology

The invention relates to the field of biotechnology primer design, in particular to a target species specific primer design system, method and device based on information entropy. The system comprises a data acquisition module, a data screening module and a data optimization module, the data screening module is used for acquiring short sequence fragment data with identity and coverage greater than or equal to 80%, and the data optimization module is used for processing the short sequence fragment data with identity and coverage greater than or equal to 80%. According to the method, short sequence fragments covering 90% of genomes are screened out, the entropy value of each basic group in the short sequence fragments is obtained, quantitative scoring is conducted on the short sequence fragments according to the entropy values and coverage degree information, the short sequence fragments with the top scores are screened out, the basic groups are replaced with the most conservative basic groups, and the optimized short sequence fragments are obtained. And designing primers based on the short sequence fragments. According to the system, entropy analysis is introduced in the primer design process, and the design quality and application efficiency of primers are remarkably improved.

The present invention belongs to the field of molecular biology technology, and specifically relates to a microsatellite primer set for identifying yellow sand softshell turtle varieties, comprising a first primer set and a second primer set, wherein the sequence of the first primer set comprises: an upper primer: CTGAAGTCTGGCACTAAGCTTTCC, a lower primer: GTCTAAATTCCGAAGCGGGTAAAA; the sequence of the second primer set comprises: an upper primer: TAGCCCCGAGATTATCAGAGACAG, a lower primer: TGTGGCTGGTTGGTGTAGTAAGAA, and application of the microsatellite primer set in identifying yellow sand softshell turtle varieties. The microsatellite primer set proposed by the present invention has high conservatism and high versatility, and can accurately and quickly identify yellow sand softshell turtle varieties, thereby effectively improving the accuracy of identifying yellow sand softshell turtle varieties.

The invention provides application of a ring finger protein coding gene OsRF in regulation and control of rice grain shape and grain weight, the gene OsRF for coding the ring finger protein is separated and cloned from rice Nipponbare, and the gene is targeted by rice small RNA OsmiR530. In order to prevent the OsmiR530 from being cut and improve the expression level of the OsmiR530, artificial synonymous mutation is carried out on the OsRF recognized sequence by the OsmiR530, a mutant OsRF fragment (mOsRF) of which the recognition sequence is subjected to synonymous mutation is created by utilizing overlapping PCR (Polymerase Chain Reaction), an overexpression vector of the mOsRF is constructed and is overexpressed in rice, and the grain width and the grain weight of transgenic rice are obviously increased. Therefore, the overexpression of the mOsRF in the rice is of great significance for obtaining round-grain rice and increasing the rice yield, and a new resource and a new research method are provided for rice grain shape improvement breeding.

The invention discloses a preparation method and application of a vibrio outer membrane protein A multi-epitope antigen and a recombinant antigen thereof, and is characterized in that a protein multi-epitope antigen sequence synthesized by outer membrane proteins of vibrio splendidus, vibrio parahaemolyticus and vibrio alginolyticus is designed by utilizing a multi-epitope technology, and the amino acid sequence of the protein multi-epitope antigen sequence is shown as SEQ ID NO.4; the preparation method of the multi-epitope recombinant antigen comprises the following steps: synthesizing a multi-epitope gene according to a multi-epitope antigen amino acid sequence, connecting the multi-epitope gene to a pET-28a (+) vector, transforming a plasmid containing the multi-epitope gene into a protein expression type competent cell, screening out positive clones, and performing protein expression; the method comprises the following steps: carrying out protein purification by using affinity chromatography to obtain a multi-epitope recombinant antigen, further preparing a multi-epitope antibody by using the multi-epitope recombinant antigen, and detecting whether a to-be-detected sample solution contains vibrio or not by using the multi-epitope antibody as a labeled protein and using a trace thermophoresis technology, so that the method has the advantages of high detection speed and strong specificity.

The application discloses a city annual water consumption prediction method based on variable point detection and segmented double-layer fusion, relates to the technical field of city water consumption prediction, and comprises the following steps: collecting city water consumption historical data and preprocessing to obtain annual water consumption data; calculating a water consumption growth rate sequence of adjacent years, searching for an optimal abnormality sub-section in combination with an abnormal section length range, and identifying a water consumption time sequence variable point section; a plurality of prediction model sets are constructed; one-step prediction is performed through rolling, prediction errors of normal sections and variable point sections are respectively counted, and two types of global fusion weights are generated; dynamic weights are solved in combination with a k-year rolling error cache and an exponential weighting mechanism, and double-layer weights are fused; whether the target year is in a variable point section or not, parameters are adaptively adjusted, corresponding weights are matched, city water consumption final prediction results are weighted and calculated, and output. The application still has good accuracy and robustness in the variable point section.

This invention discloses a primer-probe combination for detecting multiple types of Lactobacillus and its applications, belonging to the field of biotechnology. The primer-probe combination includes a primer-probe combination for detecting *Lactobacillus casei*, a primer-probe combination for detecting *Lactobacillus paracasei*, and a primer-probe combination for detecting *Lactobacillus rhamnosus*. The primer-probe combination of this invention can be used for both singleton and multiplex PCR detection, and can accurately detect *Lactobacillus casei*, *Lactobacillus paracasei*, and *Lactobacillus rhamnosus*, enabling the authentication of products containing Lactobacillus. This invention provides a more convenient method for detecting *Lactobacillus casei*, *Lactobacillus paracasei*, and *Lactobacillus rhamnosus*.

The application relates to the technical field of voltage compensation control, in particular to a power distribution line dynamic compensation adjustment method for preventing voltage fluctuation. The method comprises the following steps: acquiring voltage deviation degrees and reactive power variation synchronization degrees between each trunk node and each compensation point at each moment; acquiring limit coefficients of each trunk node, and dividing an alternating current power grid area into reactive power compensation coverage sub-areas dominated by each compensation point; calculating line losses of trunk lines in each reactive power compensation coverage sub-area, and acquiring multi-time scale estimation information; acquiring compensation parameters of reactive power compensation devices in each reactive power compensation coverage sub-area, and then correcting compensation capacities of the reactive power compensation devices to dynamically compensate the power distribution line. The application aims to reduce active power loss and voltage drop and improve overall power quality.

The invention belongs to the technical field of biology, and discloses a method for determining a multivalent antigen sequence of an anti-periodontitis red complex, which comprises the following steps: firstly, screening out key virulence factor antigens (FimA-II, RgpA, Msp and BspA) from three core pathogenic bacteria of the red complex: porphyromonas gingivalis, treponema denticola and fusisterone; then, independently cloning each antigen gene to a pUC57 cloning vector, constructing a single antigen recombinant plasmid, and avoiding intergene interference by designing a specific enzyme cutting site; and finally, through plasmid transformation, positive clone screening and double enzyme digestion verification, the plasmid quality is ensured. The obtained single antigen plasmid can be flexibly combined and used, is beneficial to subsequent multivalent vaccine development, and has the advantages of wide antigen coverage, high expression reliability, flexible construction strategy, easiness in industrialization and the like.

The invention discloses a primer probe combination for detecting various bifidobacteria and application of the primer probe combination, and belongs to the field of molecular biological detection. The primer probe combination provided by the invention comprises a primer probe group for detecting bifidobacterium breve, a primer probe group for detecting bifidobacterium bifidum and a primer probe group for detecting bifidobacterium adolescentis. Based on the primer probe combination, the invention respectively develops a single PCR detection method and a triple PCR detection method for detecting the three bifidobacteria. Experimental results show that the detection method provided by the invention can be used for accurately detecting bifidobacterium breve, bifidobacterium bifidum and bifidobacterium adolescentis. According to the invention, a foundation is laid for authenticity identification of products containing bifidobacterium breve, bifidobacterium bifidum and bifidobacterium adolescentis, and a more convenient method is provided for detection of bifidobacterium breve, bifidobacterium bifidum and bifidobacterium adolescentis.

This invention relates to an antibody or antigen-binding fragment thereof targeting a conserved region of the porcine reproductive and respiratory syndrome virus (PRRSV) GP5 protein. The conserved region is selected from amino acids 32–101 and / or 125–199. The antibody comprises a heavy chain variable region and a light chain variable region. The amino acid sequence of the heavy chain variable region is shown in SEQ ID NO: 2; the amino acid sequence of the light chain variable region is shown in SEQ ID NO: 4. This antibody or its antigen-binding fragment comprises a heavy chain and a light chain and can specifically bind to the GP5 protein, and can be used to detect the presence or content of PRRSV GP5 protein in a sample.