Novel vaccine for preventing COVID-19 and preparation method thereof

A COVID-19, a new type of technology, applied in the field of genetic engineering and molecular immunology, can solve the problems of exacerbation of lung injury in mice, and achieve the effect of reducing lung injury, weak antibody induction ability, and high conservation

CN111939250AActive Publication Date: 2020-11-17ZHENGZHOU UNIV
5 Cites 21 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Publication Date
2020-11-17

Smart Images

  • Figure 1
    Figure 1
  • Figure 2
    Figure 2
  • Figure 3
    Figure 3
Patent Text Reader

Abstract

Provided is a novel vaccine for preventing COVID-19, the nucleotide sequence of an antigen of the novel vaccine is SEQ NO: 1, the amino acid sequence of the antigen of the novel vaccine is SEQ NO: 2,and the antigen of the vaccine comprises two functional parts: an S protein receptor binding structural domain capable of inducing a specific neutralizing antibody and a T cell related N protein truncated peptide fragment capable of inducing and activating effector T cells; The vaccine disclosed by the invention has the characteristics that the T cell related N protein truncated peptide fragment has weak capability of inducing the generation of the N protein antibody, so that a vaccine inoculator and a COVID-19 infected patient can be identified by using the N protein antibody, and the vaccineantigen does not induce the generation of the N protein antibody, so that lung injuries can be reduced, and the vaccine is safer. The cell vaccine disclosed by the invention is low in manufacturing cost, and can induce generation of virus-specific neutralizing antibodies and T cell immune response.
Need to check novelty before this filing date? Find Prior Art

Description

technical field

[0001] The invention belongs to the technical field of genetic engineering and molecular immunology, and in particular relates to a novel vaccine for preventing COVID-19 and a preparation method thereof. Background technique

[0002] SARS-CoV2, also known as 2019-nCoV, is a novel RNA virus of the subgenus Sarbecovirus in the family Coronaviridae, which has caused the global epidemic of 2019 novel coronavirus pneumonia (COVID-19). As of August 10, the number of global virus infections has exceeded 19.86 million, and the death toll has exceeded 730,000. There are currently 139 candidate vaccines under preclinical evaluation, and 25 candidate vaccines are under clinical evaluation or clinical trials, some of which, such as recombinant adenovirus vector vaccines and fire-fighting vaccines, have entered Phase II clinical trials and have shown encouraging results. However, there are still some deficiencies in the antigen design of various vaccines, which need to b...

Examples

preparation example Construction

[0039] A preparation method of a novel vaccine for preventing COVID-19 as described above, comprising the following steps:

[0040] (1) First construct a lentiviral vector capable of secreting and expressing GP96-hFc, infect and screen out a cell line that can stably secrete and express GP96-hFc HEK293T, see SEQ NO: 8 for the nucleotide sequence, and SEQ NO: 8 for the protein sequence 9;

[0041] (2) Construct a lentiviral vector capable of chimerically expressing the S-protein receptor-binding domain of SARS-CoV2 and the truncated N-protein T-cell-associated peptide, and screen out the secreted and expressed GP96- hFc is a HEK293T cell line chimerically expressing the S protein receptor binding domain of SARS-CoV2 and the truncated N protein T cell-associated peptide;

[0042] (3) Collect the cells obtained in step 2) under sterile conditions, and wash them with sterile normal saline or PBS (phosphate buffered saline) to adjust the cell concentration to 1×10 6 ~1×10 7 / 100...

Embodiment 1

[0046] Example 1: Bioinformatics analysis of the S protein of SARS-CoV2

[0047] The S protein of SARS-CoV2 can be divided into multiple functional domains by referring to SARS-CoV related research and UniProt public data; it can be seen that the S protein is mainly composed of S1 and S2 subunits ( figure 1 A), where the receptor-binding domain (RBD) in S1 can bind to angiotensin-converting enzyme 2 (ACE2) to trigger a conformational change of the homotrimer, while the S2 subunit can further form a six-helix bundle, promoting Fusion of virus and host cell membrane. Analysis of potential 3D structure-based B-cell antigens of the receptor-binding domain of the SARS-CoV2 S protein using Discospe software ( figure 1 B), using the IEDB database to analyze the potential linear B cell epitopes of the SARS-CoV2 full S protein ( figure 1 C), showing less structure-based B-antigens and more linear B-cell antigens. The structures of the RBD domains from SARS-CoV2 (PDB: 6LZG) and SARS-...

Embodiment 2

[0049] Example 2: Verification of the expression of SARS-CoV2 spike protein and nucleocapsid protein

[0050] The S protein gene (SEQ NO:11) of SARS-COV and the nucleocapsid protein (SEQ NO:12) of SARS-COV2 were synthesized by Sangon Biotech according to the sequence published by the NCBI database ((MN908947.3), and constructed into pcDNA3.1 -his tag (hygro) vector. The codon-optimized SARS-CoV2 plasmid was purchased from Sino Biological. The following primers were used to construct PCDNA3.1-his-optS, PCDNA3.1-his-optS1, PCDNA3.1-his- optNRBD (from N-terminus to RBD domain) expression.

[0051] Spike-optF (codon optimized): ACTTAATTAAGCCACCATGTTTGTGTTCCTGGTGCTGCT,

[0052] Spike-opt-R: TAACCGGTGGTGTAGTGCAGTTTCACTCCTTTCA;

[0053] Spike-optS1-R: TAACCGGTGCTGTTGGTCTGGGTCTGGTAGG;

[0054] Spike-optNRBD-R: TAACCGGTTCCATTGAAGTTGAAGTTCACACACTT;

[0055] The corresponding expression plasmids were transfected into HEK-293T cells using PEI, and the expression of corresponding genes...