Enzyme-linked immunosorbent assay vector and kit for detecting avian leukosis P27
An enzyme-linked immune reagent and enzyme-linked immune reaction technology are applied in the field of serological diagnosis of animal diseases, which can solve the problems of no avian leukemia antigen enzyme-linked immune detection kit, poor sensitivity, false positives, etc. The effect of low cost and easy operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
preparation example Construction
[0082] Preparation of LB liquid medium: Add 5g of yeast extract, 10g of peptone and 10g of NaCl into the container; add distilled water to 1000ml, adjust the pH to 7.0-7.2 with NaOH and HCl, and pack and sterilize.
[0083] instrument
[0084] Table 1 Instrument source and model
[0085]
[0086]
Embodiment 1
[0087] Embodiment 1. Preparation of the recombinant plasmid of the avian leukosis virus P27 gene
[0088] According to the nucleotide sequence of RSV P27 gene included in GenBank (the sequence is 1381agactggctg atacggtcaggaccaagggc ttacgatccc cgatcactat ggcggaggtg
[0089] 1441 gaagcgctta tgtcctcccc gctgctgccg catgacgtta cgaatctaat gagagttatt
[0090] 1501 ttaggacctg ccccatatgc cttgtggatg gacgcttggg gtgtccaact acagacggtt
[0091] 1561 atagcggcag ccactcgcga cccccgacac ccagcgaatg gtcaagggcg gggggaacgg
[0092] 1621 actaatttgg atcgcttaaa gggtttagct gatgggatgg tgggcaaccc gcagggtcag
[0093] 1681 gccgcattat taagaccggg ggaattggtt gctattacgg cgtcggctct ccaggcattt
[0094] 1741 agagaggttg cccggctggc ggaacctgct ggtccatggg cggacattac gcagggacca
[0095] 1801 tctgagtcct ttgttgattt tgccaatcgg cttataaagg cggttgaggg gtcagatctc
[0096] 1861 ccgccttccg cgcgagctcc ggtgatcatt gactgcttta ggcagaagtc acagccagat
[0097]1921 atccagcagc ttatacgggc agcaccctcc acgctgacca ccccaggaga gataatcaaa ...
Embodiment 2
[0100] Example 2. Expression of Avian Leukosis Virus P27 Protein
[0101] Induced expression of avian leukosis P27 gene in Escherichia coli: transform the recombinant plasmid into Escherichia coli BL21, inoculate it in LB solid medium containing ampicillin (Amp) resistance, culture overnight at 37°C, and take 3~ 4 single colonies were inoculated in LB liquid medium containing Amp, cultured to OD at 37°C with shaking (250rpm) 600 =0.6, add IPTG (isopropyl-β-D-thiogalactopyranoside) to a final concentration of 1mmol / l, and continue to culture at 37°C for 3 hours to obtain the expressed protein, the expression of avian leukemia P27 protein is 565mg / L. At the same time, an uninduced negative control was cultured. The expressed protein was identified by SDS-PAGE and Western-blot, and the results were as follows figure 1 shown.
PUM

Abstract
Description
Claims
Application Information

- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com