Supercharge Your Innovation With Domain-Expert AI Agents!

Qinghai-Tibet Plateau wild barley HsCIPK5 gene

A barley, wild technology, applied in the field of genetic engineering, can solve problems such as far-flung requirements and little research on cross-species utilization of tolerance alleles

Inactive Publication Date: 2012-04-04
ZHEJIANG NORMAL UNIVERSITY
View PDF0 Cites 1 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the research on the annual wild barley resources on the Qinghai-Tibet Plateau in my country is far from meeting the requirements for excavating and utilizing these resources in general. The research on the cloning of the environmental stress tolerance alleles contained in it and the cross-species utilization through transgenic means have not been carried out. few

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Qinghai-Tibet Plateau wild barley HsCIPK5 gene
  • Qinghai-Tibet Plateau wild barley HsCIPK5 gene
  • Qinghai-Tibet Plateau wild barley HsCIPK5 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] The technical route adopted in the present invention is as figure 2 shown.

[0021] 1. According to the relevant literature, search and obtain the known CIPK5 gene sequences in other species of Poaceae (such as rice, wheat, sorghum, corn) from various databases, and according to the coding rules and arrangement of exons and introns Search and locate the open reading frame ORF (open read frame), and then obtain the complete coding sequence CDS (coding sequence).

[0022] 2. Use the complete or partially conserved sequence of OsCIPK5 as a probe to search and compare (nBlast or tBlastn) various barley nucleotide sequence libraries, and speculate that a sequence with high homology may be part of HsCIPK5 in wild barley sequence, the sequence is listed as the seed sequence for the next step of electronic assembly and extension.

[0023] 3. Using the seed sequence as a probe, repeatedly search the above database, save the retrieved homologous sequence on the PC, run the DNA...

Embodiment 2

[0030] Example 2 Obtaining of the full sequence of the HsCIPK5 gene

[0031] 1.1 Primer design (the underlined sequence is the restriction site):

[0032] HsCIPK5-KpnI-F:CGG GGTACC ATGGAGAGGAAGTCCACCATCCTCATG

[0033] HsCIPK5-XbaI-R:TGC TCTAGA TTAAATGACATTCCTTTTGGTCGACTT

[0034] Table 1 reaction system

[0035]

[0036] Table 2PCR reaction parameters

[0037] number of cycles

temperature(°C)

time(s)

temperature(°C)

time(s)

temperature(°C)

time(s)

1

94

180

-

-

-

-

30

94

30

65

15

72

60

1

72

600

[0038] 1.2 Experimental results

[0039] 1.2.1PCR results

[0040] Get PCR product 5ul electrophoresis, obtain a clear band about 1.4kb, its size is similar to the fragment size of the CIPK5 gene of known rice and Arabidopsis ( image 3 ), it can be preliminarily considered that the desired target DNA fragment has be...

Embodiment 3

[0044] 1 Primer design

[0045] HsCIPK5-898-F: GAAGGCAGCAGGGCAGAACAACCA

[0046] HsCIPK5-1147-R: TGGATCCCTGCAGCGTCACAAGTC

[0047] Hvactin-real-F2: CCAAAAGCCAACAGAGAGAA

[0048] HvACTIN-real-R2: GCTGACACCATCACCAGAG

[0049] 2 experimental protocol

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a Qinghai-Tibet Plateau wild barley HsCIPK5 gene, which is characterized by being defined with a nucleotide sequence of SEQ ID NO:1. In the invention, an electron probe is designed by using a paddy rice OsCIPK homologous gene sequence, and a target gene coding sequence (CDS) is obtained by searching homologous fragments from various existing barley nucleotide sequence libraries such as EST (Expressed Sequence Tags) library and adopting methods such as cluster analysis, electron splicing and the like. Structural analysis and function prediction are performed on a target gene by using a bioinformatics method. Wild barley total RNAs (Ribonucleic Acids) are extracted for preparing cDNAs (complementary DNAs) and designing a PCR (Polymerase Chain Reaction) primer, and a target gene is cloned through a PCR technology. The obtained target gene is subjected to TA cloning, sequencing and sequence analysis.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to the HsCIPK5 gene of wild barley on the Qinghai-Tibet Plateau. Background technique [0002] The wild germplasm resources of Gramineae on the Qinghai-Tibet Plateau are very rich, especially its unique annual wild barley (Hordeum spontoneum C. Koch), which has always been a precious wild grass resource of international attention and a national treasure that has yet to be developed and utilized. Due to long-term growth in various harsh environments and long natural evolution, a unique resistance (tolerance) gene network (Nevo et al., 1997) and rich allelic variation have been formed. Great use value. In recent years, with the support of key projects of the National Natural Science Foundation of China, we have screened and identified the apparent characteristics and physiological indicators of these wild resources under environmental stress tolerance, and systematically ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/54C12N9/12
Inventor 潘建伟王文祥郑仲仲沈金秋马伯军
Owner ZHEJIANG NORMAL UNIVERSITY
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More