Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

Recombinant corynebacterium glutamicum capable of being used for highly yielding L-phenylalanine and application thereof

A technology of Corynebacterium glutamicum, phenylalanine, applied in bacteria, microorganism-based methods, microorganisms, etc., can solve the problems of poor enzyme stability, limited sources, and high cost

Inactive Publication Date: 2013-05-01
JIANGNAN UNIV
View PDF2 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In recent years, due to the high cost and limited sources of main raw materials such as substrates and enzymes, and the poor stability of enzymes in the reaction process, the enzymatic production of L-Phe has also been greatly restricted.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Recombinant corynebacterium glutamicum capable of being used for highly yielding L-phenylalanine and application thereof
  • Recombinant corynebacterium glutamicum capable of being used for highly yielding L-phenylalanine and application thereof
  • Recombinant corynebacterium glutamicum capable of being used for highly yielding L-phenylalanine and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0025] Construction and Identification of Embodiment 1 Recombinant Bacteria

[0026] According to the Genebank accession sequence number NC_000913.2, the aroF gene was amplified by PCR (primer F: CCAATGCAT AAAGGAGGA CACGC ATGCAAAAA

[0027] GACGCGCTGAATAACG; R: CTAG TCTAGA TTAAGCCACGCGAG

[0028]CCGTCA), cloned into the shuttle vector pXMJ19 (Jakoby, M., C.E. Ngouoto-Nkili, and A. Burkovski, Construction and application of new Corynebacterium glutamicum vectors. Biotechnology Techniques, 1999.13(6): p.437-441.), finally The shuttle expression plasmid pXMJ19-aroF containing the aroF gene was obtained. According to the plasmid pAP-B03 (Zhou, H., X.Liao, T.Wang, G.Du, and J.Chen. 2010.Enhanced L-phenylalanine biosynthesis by co-expression of pheA fbr and aroF wt .Bioresour Technol101:4151-4156.) The gene pheA that acquires anti-feedback inhibition fbr (Primer F: CCC AAGCTT AAAGGAGGACACGCATGACATCGGAAAACCCGTTACT; R:AAAA CTGCAG TCAGGTT

[0029] GGATCAACAGGCACTA) obtain...

Embodiment 2

[0034] Embodiment 2 fermentation produces L-Phe

[0035] The recombinant strain C. glutamicum was compared with the starting strain in the fermentation experiment. In C.glutamicum ATCC13032, the shikimic acid metabolic pathway of L-Phe synthetic metabolic pathway was overexpressed, and the key enzyme gene of chorismic acid metabolic pathway made the production of L-Phe reach 3.47g / L. The highest yield of L-Phe of each enzyme gene was 4.86gL. However, the production of L-Phe could not be detected during the fermentation process of the fermentation broth of the starting strain C. glutamicum ATCC13032.

[0036]

[0037]

[0038]

[0039]

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses recombinant corynebacterium glutamicum capable of being used for highly yielding L-phenylalanine and a method for producing the L-phenylalanine (Phe) by fermentation and belongs to the field of metabolic engineering. According to the invention, a corynebacterium glutamicum engineering strain C.glutamicum19AF / 99TP capable of being used for highly yielding the L-Phe is obtained in a corynebacterium glutamicum type strain ATCC13032 by carrying out induction expression on the following four genes: a 3-deoxy-D-arabino-heptulosonate-7-phosphate synthase gene, a chorismate mutase / prephenate dehydratase gene which has resistance to feedback inhibition, a transketolase gene and a phosphoenolpyruvic acid synthetase gene. A shikimic acid metabolic pathway of an L-Phe synthetic metabolic pathway is over-expressed in the C.glutamicum ATCC13032; a key enzyme gene of a chorismic acid metabolic pathway enables the yield of the L-Phe to reach 3.47g / L; two enzyme genes which combines an expression center metabolic pathway to improve a precursor enables the highest yield of the L-Phe to reach 4.86g / L; and the original strain ATCC13032 which is used as a contrast strain cannot detect accumulation of the L-Phe in the integral fermenting process.

Description

technical field [0001] The invention relates to a recombinant Corynebacterium glutamicum with high production of L-phenylalanine and application thereof, in particular to a metabolically modified recombinant Corynebacterium glutamicum and a method for producing L-phenylalanine. Background technique [0002] Phenylalanine (Phenylalanine), namely D, L-α-amino-β-phenylpropionic acid, has three racemic DL-type, L-type and D-type, which has biologically active optical isomerism The body is L-phenylalanine (L-Phenylalanine, L-Phe), and the specific rotation is -35.1°. L-Phe, also known as L-phenyl-alanine, is a white or colorless crystalline powder solid at room temperature. The solubility in water is 29.6g / L, and it is insoluble in methanol, ethanol and ether. L-Phe widely exists in eggs, milk and animal protein in nature, with a content of 5%-6%; L-Phe also exists in plant protein, with a content of about 1%. [0003] L-Phe is one of the eight essential amino acids that cannot...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N1/21C12P13/22C12R1/15
Inventor 陈坚张传志堵国成康振
Owner JIANGNAN UNIV
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products