Corn transcription factor ZmWRKY44 and application thereof

A transcription factor, corn technology, applied in the fields of application, genetic engineering, plant genetic improvement, etc.

CN103305530AInactive Publication Date: 2013-09-18SICHUAN AGRI UNIV
2 Cites 9 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Publication Date
2013-09-18
Estimated Expiration
Not applicable · inactive patent

Smart Images

  • Figure 1
    Figure 1
  • Figure 2
    Figure 2
  • Figure 3
    Figure 3
Patent Text Reader

Abstract

The invention relates to the field of plant stress resistance, and in particular relates to a corn transcription factor ZmWRKY44 and an application thereof. The corn transcription factor ZmWRKY44 has a nucleotide sequence as shown in SEQ ID No.1. According to the technical scheme, the expression condition of the adversity-tolerant gene of a transcription factor ZmWRKY44 arabidopsis plant under a salt stress condition is observed, the influence on the seed germination rate of the transcription factor ZmWRKY44 abrabidopsis plant caused by salt stress is relieved, and the plant growth is inhibited, so that a transgenic plant has a proper sensibility to the salt stress, and the transcription factor ZmWRKY44 can be used for enabling the plants to have a salt-tolerance property.
Need to check novelty before this filing date? Find Prior Art

Description

technical field

[0001] The invention relates to the field of plant stress resistance, in particular to maize transcription factor ZmWRKY44 and its application. Background technique

[0002] As an important food, feed and economic ternary crop in my country, corn is affected by various adverse external environments such as pests, drought, salt damage, cold damage, and high temperature during its growth, thereby inhibiting its growth and development. Applying modern molecular biology techniques to excavate important stress-resistant genes and carry out genetic transformation or aggregate them with other excellent traits through molecular marker-assisted selection is one of the effective methods to obtain maize varieties with strong stress tolerance and improve maize yield. one. Functional research on stress-related genes is a prerequisite for the development and utilization of these genes. WRKY transcription factors play an important regulatory role in plant biotic stress, a...

Examples

Embodiment 1

[0026] 1. Cloning of ZmWRKY44 gene

[0027] The specific primer W44F / R of ZmWRKY44 was used to amplify the cDNA of this gene from maize inbred line 178, and the target band of ZmWRKY44 gene 1282bp was obtained (such as figure 1 ). It was recovered and sequenced, further proving that the cloned fragment was the ZmWRKY44 gene.

[0028] W44F: atCCCGGGCAGAAAGTCAGGGGTAGGGAGA

[0029] W44R: atCCCGGGGAAGAATCTGTCTCTTCTAGAGACCG

[0030] ZmWRKY44 gene sequence:

[0031] ATCCCGGCAGAAAGTCAGGGTAGGGAGAAGGATGGCGATGGCGATGGCAAGTATGCC GCCGGCTTGTGCGGCAACCGAGCTGGTGGCCAAGGGGAGGGAGTCGGCTGCAGTTCTCAA GGCCATGCTCGGCCAGCTTCCTGCGGCGGCGACGCCCCATGATGGTCTCCGGGATCTGGCC GAGCAGGTCCTCCGCTGCTGCGACCGAGCTCTGGCGGCCTTGCTCAGAGGCGCGGCAACG GAGGAGGCTGCCTGCAGCAGTTCGGCCAGGAAGCGCCGCAAGCAGCCAGCAGAGCGGCA GGGCGGCCTGGCTCCTCCTCCTCCTTCTCCTGCTGCGACGGGATCCAAGACCAAGAGGATG AGGTAATTACTACTATGCAGCATAGCTCCTTTTGAGCTAATTACCAGCTTAAGTATACAACGT ATAATCATCTACTACTGAATCTGCAGGATGAGCCGTGGAGAGCGGGGGACACGAGCGGAGA AGAAAGAAACAATGGAGGACGGCTTCATCTGGA...