A method for detecting and identifying Mediterranean white snails by PCR

A snail and reaction technology, applied in the field of molecular biology detection and identification, can solve the problems of little knowledge of terrestrial mollusk classification, and achieve the effects of rapid and reliable detection and identification, reliable results and high specificity

Active Publication Date: 2016-04-27
INSPECTION & QUARANTINE TECH CENT OF FUJIAN ENTRY EXIT INSPECTION & QUARANTINE BUREAU
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to historical reasons, the vast majority of plant quarantine personnel at border ports are majors in plant protection and know little about the classification of terrestrial molluscs. common technical challenges

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A method for detecting and identifying Mediterranean white snails by PCR
  • A method for detecting and identifying Mediterranean white snails by PCR

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0016] Embodiment 1: Mediterranean white snail PCR primer specificity test

[0017] 1. Preparation of materials

[0018] The snails tested are as follows: Mediterranean white snail Cernuella Virgata (DaCosta, 1778) (Australian specimen), Mediterranean white snail Cernuella Virgata (DaCosta, 1778) (New Zealand specimen), wrinkled snail Camaenacica tricosa , Boling Samo Satsumastenozona , Zhiba snail Bradybaenavirgovirgo , garden snail Cepaea hortensis Tianshui baby snail Pupinidius tianshuiensis , cover big snail Helixpomatia , young stone ring rib snail Plectotropis lithina , isomorphic snail Bradybaenasimilaris , umbilical snail Aegistapermellita ; short-snail Bradybaenabrevispira , Satsuma snail Satsumauncopila , bright big snail Helix lucorum , Cystosnail Physaacuta , pizza tea snail Thebapisana .

[0019] The above-mentioned snails were intercepted in the national port quarantine or obtained through domestic investigation and collection. Afte...

Embodiment 2

[0031] Embodiment 2: PCR detection sensitivity test of Mediterranean white snail

[0032] The Mediterranean white snail DNA stock solution (100ng / μL) extracted in Example 1 was diluted into 10ng / μL, 1ng / μL, 100pg / μL, 10pg / μL, 1pg / μL, 100fg / μL and A total of 7 different concentration gradients of 10fg / μL.

[0033] PCR amplification reaction system: the total volume is 25 μL, including 12.5 μL of 2×TaqPCR MasterMix mixture, 0.5 μL of upstream and downstream primers, 3 μL of DNA template, and sterilized ddH for the rest 2 O make up. After mixing, put it into a PCR amplification instrument for amplification.

[0034] The PCR amplification reaction program was: 94°C pre-denaturation for 5 minutes; 94°C for 30 s, 46°C for 30 s, 72°C for 1 min, 25 cycles; 72°C for 10 min, and the reaction was terminated.

[0035] Detection and identification of PCR products: Take 10 μL of PCR products and electrophoresis on 1.5% agarose gel (containing ethidium bromide) at 130V for about 30 minu...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

PropertyMeasurementUnit
volumeaaaaaaaaaa
Login to view more

Abstract

The invention discloses a method for detecting and identifying the Mediterranean white snail by PCR. The method uses specific primers to identify the molecular characteristics of the Mediterranean white snail; the upstream primer of the PCR reaction is HP-(P1):5'-? GTTATTGTTACTGCTCACGC? -3', the downstream primer is HP-(P2): 5'-? CTGCTAAGACAGGGAGAGAT? -3'. The total volume of the PCR reaction system is 25 μL, in which 2×Taq? PCR? MasterMix? 12.5 μL, 0.5 μL of upstream and downstream primers, 3 μL of DNA template, and the rest was supplemented with sterilized ddH2O; the PCR reaction program was: 94 °C pre-denaturation for 5 min; 30s, 46°C? 30s, 72°C? 1 min, 25 cycles; 72 ° C extension for 10 min, the end of the reaction. The method of the invention can quickly and accurately detect and identify the Mediterranean white snail. The invention provides a new technical means for the detection and identification of the Mediterranean white snail in the List of Imported Plant Quarantine Pests of the People's Republic of China, and is of great significance for preventing the spread and spread of the Mediterranean white snail.

Description

technical field [0001] The invention relates to the field of molecular biology detection and identification, in particular to a method for PCR detection and identification of Mediterranean white snails. Background technique [0002] mediterranean white snail Cernuella Virgata (DaCosta, 1778) belongs to Stylommatopgora and Hygromiidae. It is a quarantine pest that has attracted much attention in the world. The United States, Chile, Japan, New Zealand, Australia and other countries and regions implement quarantine on it. In September 2012, the snail was added as a member of the "List of Imported Plant Quarantine Pests of the People's Republic of China". Thebapisana Müller and others are very similar, often difficult to distinguish, and only senior terrestrial mollusc taxonomy experts can identify, and the identification of eggs and young snails is even more difficult. Due to historical reasons, the vast majority of plant quarantine personnel at border ports are majors in pl...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/686C12Q2531/113
Inventor 王沛周卫川陆军林阳武肖琼崔俊霞
Owner INSPECTION & QUARANTINE TECH CENT OF FUJIAN ENTRY EXIT INSPECTION & QUARANTINE BUREAU
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap