Patents
Literature
Hiro is an intelligent assistant for R&D personnel, combined with Patent DNA, to facilitate innovative research.
Hiro

34results about How to "Result Reliability Guarantee" patented technology

Primer and method for rapid molecular detection of eelworm

InactiveCN1482254AFast and reliable detectabilityFast and reliable identificationMicrobiological testing/measurementFermentationAgricultural scienceMeloidogyne incognita
The present invention is one kind of primer for fast molecular detection of root nematode, especially for fast molecular detection and identification of Southern, Java and peanut root nematode, and belongs to the field of crop disease and pest prevention and treatment and plant quarantine technology. Three pairs of primer, including MI-F / R, MJ-F / R and MI-F / MT-R, are designed for specifically proliferation of products with 955 bp, 517 bp and 799 bp in colony of Southern root nematode, Java root nematode and Southern, Java and peanut root nematode separately. The three pairs of primer has proliferation sensitivity of 1 / 3 two-instar larva, male adult and female adult. These primers may be used in fast detection and identification of root nematode in soil sample and root sample.
Owner:NANJING AGRICULTURAL UNIVERSITY

Method for identifying helix pomatia by PCR (polymerase chain reaction) detection

The invention discloses a method for identifying helix pomatia by PCR (polymerase chain reaction) detection, which uses specific primers to identify molecular characteristics of helix pomatia. The forward primer for the PCR reaction is HP-(P1): 5'-TTCGTTGAGAGTTAGG-3', and the reverse primer is HP-(P2): 5'-ATAGTAATAGCACCAGC-3'. The total volume of the PCR reaction system is 25 mu L, wherein the 2*TaqPCRMasterMix is 12.5 mu L, the forward and reverse primers are respectively 0.5 mu L, the DNA (deoxyribonucleic acid) template is 2 mu L, and the rest is sterilized ddH2O. The PCR reaction process comprises the following steps: pre-denaturating at 5 DEG C for 5 minutes; treating at 95 DEG C for 30 seconds, 45 DEG C for 30 seconds and 72 DEG C for 1 minute, and repeating 30 times; and extending at 72 DEG C for 10 minutes, and finishing the reaction. The method disclosed by the invention can quickly and accurately detect and identify helix pomatia. The invention provides a new technical means for detection and identification of helix pomatia in the Catalogue of Quarantine Pest for Import Plants to the People's Republic of China, and has important meanings for preventing helix pomatia from spreading and diffusion.
Owner:INSPECTION & QUARANTINE TECH CENT OF FUJIAN ENTRY EXIT INSPECTION & QUARANTINE BUREAU

Phytophthora capsici LAMP (Loop-mediated isothermal Amplification) primer and rapid detection method thereof

InactiveCN103525913AFast and reliable detectabilityFast and reliable identificationMicrobiological testing/measurementMicroorganism based processesBiotechnologyDisease
The invention discloses a phytophthora capsici LAMP (Loop-mediated isothermal Amplification) primer and a rapid detection method thereof, which are specially used for phytophthora capsici specific detection. The invention mainly designs a phytophthora capsici LAMP primer (F3, B3, FIP and BIP); the primer is subjected to isothermal amplification and a 50micromole / L Calcein-500micromole / L MnCl2 developing agent is added to develop or agarose gel electrophoresis detection is carried out, so as to observe green fluorescent light or a ladder belt with an LAMP characteristic. The phytophthora capsici LAMP primer and the rapid detection method thereof can be used for rapid, sensitive and accurate detection of plants infected by phytophthora capsici and the phytophthora capsici in the soil in production practice and can also be used for early diagnosis of field diseases and the monitoring and identifying of bacteria, so as to provide reliable technological and theoretical foundations for preventing and treating the diseases caused by the phytophthora capsici.
Owner:INST OF PLANT PROTECTION FAAS

Peronophythora litchii LAMP (loop-mediated isothermal amplification) primer and rapid detection method thereof

The invention discloses a peronophythora litchii LAMP (loop-mediated isothermal amplification) primer and a rapid detection method thereof which are specially applied to specific detection of peronophythora litchii. The peronophythora litchii LAMP primer is mainly adopted and designed, and through isothermal amplification visual inspection or agarose gel electrophoresis detection, green fluorescence can be observed or an LAMP characteristic ladder can appear. The LAMP primer and a usage method thereof can be applied to rapid, sensitive and accurate detection of the peronophythora litchii in plants infected with the peronophythora litchii in production practice, can also be applied to early diagnosis of diseases and pests in fields as well as monitoring and identification of germs, and provide reliable technical and theoretical bases for control of diseases and pests caused by the peronophythora litchii.
Owner:INST OF PLANT PROTECTION FAAS

LAMP (Loop-Mediated Isothermal Amplification) primer of phytophthora nicotianae and fast detection method thereof

The invention discloses an LAMP (Loop-Mediated Isothermal Amplification) primer of phytophthora nicotianae and a fast detection method thereof, which are especially used for specific detection of the phytophthora nicotianae. The LAMP primer adopted and designed is F3, B3, FIP and BIP, and the sequence of the LAMP primer is shown in SEQIDNO.1-4. Green fluorescence can be observed or the ladder pattern of LAMP characteristic occurs by isothermal amplification and addition of SYBRgreenI color-developing agent for color development or sepharose for gel-electrophoresis detection. The LAMP primer and the use method can be used for fast, sensitive and accurate detection of the phytophthora nicotianae in plants and soil infected by the phytophthora nicotianae in production practice, simultaneously can be used for early diagnosis of diseases in the field and monitoring and identification of germs, and provide reliable technical and theoretical basis for controlling the diseases caused by the phytophthora nicotianae.
Owner:INST OF PLANT PROTECTION FAAS

Molecule primer for detecting javanese root knot nematode and usage

A molecular detecting primer for meloidogyne features that three pairs of PCR primers, MI-FIR, MJ-F / R and MI-F / MT-R are designed for the southrn, Jawa and peanut meloidogynes, which can be specifically amplified respectively on southern, Jawa and peanut meloidogynes to obtain the amplified 955 bp, 517 bp and 799 bp products respectively. They can be used to quickly and reliably detect and verify said meloidogynes.
Owner:NANJING AGRICULTURAL UNIVERSITY

Method for detecting and identifying Helix aspersa MUller through PCR (polymerase chain reaction)

The invention discloses a method for detecting and identifying Helix aspersa MUller through PCR (polymerase chain reaction). The method comprises the step of identifying the molecular feature of the Helix aspersa MUller by using specific primers, wherein the upstream primer of PCR is HP-(P1): 5'-ACTCTTTGGTATTTGATGCG-3', and the downstream primer is HP-(P2): 5'-ACCTGCTAAAACGGGTAATG-3'. The method can be used for quickly and accurately detecting and identifying the Helix aspersa MUller. The method provides a new technical means for detection and identification of the Helix aspersa MUller in Imported Plant Quarantine Pest Directory of the People's Republic of China, and has significance for preventing the propagation and diffusion of the Helix aspersa MUller.
Owner:INSPECTION & QUARANTINE TECH CENT OF FUJIAN ENTRY EXIT INSPECTION & QUARANTINE BUREAU

LAMP (Loop-mediated isothermal amplification) detection primer for ceratocystis fimbriata and application thereof

The invention discloses an LAMP (Loop-mediated isothermal amplification) primer for ceratocystis fimbriata and application thereof, and belongs to the technical field of detection, identification andprevention and control of crop diseases. The LAMP detection primer for the ceratocystis fimbriata comprises two external primers F3 and B3, and two internal primers FIP and BIP. After LAMP on the LAMPdetection primer is carried out, color development reaction or agarose gel electrophoresis is performed, and the phenomenon that reaction liquid shows green or a ladder-shaped tape which shows the LAMP characterization can be observed. The LAMP primer for ceratocystis fimbriata and a detection method disclosed by the invention can be applied to quick, sensitive and accurate detection of plants infected with the ceratocystis fimbriata in production practice and the ceratocystis fimbriata in soil, and also can be applied to early diagnosis of diseases in the fields as well as monitoring and identification of pathogenic bacteria; and therefore, a reliable technological and theoretical basis is provided for preventing and controlling the diseases caused by the ceratocystis fimbriata.
Owner:INST OF PLANT PROTECTION FAAS

Method for detecting contents of olaquindox metabolite and carbadox metabolite in animal muscle tissue and sample pretreatment method thereof

The invention discloses a method for detecting contents of olaquindox metabolite and carbadox metabolite in animal muscle tissue and a sample pretreatment method thereof. The sample pretreatment method for detecting the contents of the olaquindox metabolite and the carbadox metabolite in the animal muscle tissue includes the steps that to-be-detected animal muscle tissue samples are taken, hydrochloric acid solution is added for acidolysis, then ethyl acetate is added to extract the olaquindox metabolite and the carbadox metabolite, and mixed liquor is obtained; MgSO4 and Nacl are added to themixed liquor, the vortex and centrifugation are carried out, and supernatant is collected from the upper layer; the supernatant is concentrated and redissolved, then methanol saturation normal hexanesolution is added, the vortex and centrifugation are carried out, the lower solution is collected, the filtration is carried out, and to-be-detected solution is obtained. The invention further discloses the method for detecting the contents of the olaquindox metabolite and the carbadox metabolite by LC-MS after sample pretreatment. The method for detecting the contents of the olaquindox metabolite and the carbadox metabolite in the animal muscle tissue and the sample pretreatment method thereof has short time consumption, easy procedure, good repeatability and high result accuracy.
Owner:BEIJING ENTRY EXIT INSPECTION & QUARANTINE BUREAU INSPECTION & QUARANTINE TECH CENT

Anoectochilus formosanus anthracnose LAMP detection primer and visible detection method thereof

The invention discloses an anoectochilus formosanus anthracnose LAMP detection primer and a visible detection method thereof, which are particularly used for the specificity detection of anoectochilus formosanus anthracnose. The anoectochilus formosanus anthracnose LAMP primer is mainly designed, and green fluorescence or a trapezoidal zone having LAMP characteristics can be observed by virtue of the developing reaction after the constant-temperature amplification of LAMP or agarose gel electrophoresis detection. The LAMP primer and the application thereof can be used for rapidly, sensitively and accurately detecting a plant infecting the anoectochilus formosanus anthracnose bacteria in the production practice and can also be used for the early diagnosis of field diseases and monitoring and identification of bacteria, so that a reliable technical and theoretical evidence can be provided for preventing and controlling the anoectochilus formosanus anthracnose.
Owner:陈子岩 +3

Aspergillus flavus LAMP (loop-mediated isothermal amplification) detection primer and visualized detection method thereof

The invention discloses an aspergillus flavus LAMP (loop-mediated isothermal amplification) detection primer and a visualized detection method of the aspergillus flavus LAMP detection primer, which are specially used for specific detection of aspergillus flavus. The invention mainly designs one aspergillus flavus LAMP detection primer (comprising a pair of outer side primers and one pair of inner side primers); green fluorescence or a trapezoidal zone with an LAMP characteristic can be observed by carrying out isothermal amplification and adding a 50micronM Calcein-500micronM MnCl2 developing agent to develop or carrying out agarose gel electrophoresis detection. The aspergillus flavus LAMP detection primer and the visualized detection method of the aspergillus flavus LAMP detection primer can be used for visualized detection of aspergillus flavus in crops including peanuts, corns and the like which are infected by the aspergillus flavus in production practices, and can also be used for early diagnosis, monitoring and identification of bacteria in tissues of the peanuts or the corns which are naturally attacked.
Owner:INST OF PLANT PROTECTION FAAS

Method for rapidly identifying resistance of phytophthora melonis to CAA bactericides and special primer

InactiveCN102876773AResistance delay and controlTimely adjustment of disease control strategiesMicrobiological testing/measurementTransferasesAgricultural scienceRibonucleotide synthesis
The invention relates to a ribonucleotide point mutation method for rapidly identifying the resistance of phytophthora melonis to CAA bactericides and a special primer, and belongs to the technical field of molecular organisms. The specific prier comprises a DNA molecule shown in SEQ ID NO:1 and a DNA molecule shown in SEQ ID NO:3. The molecule detection method for detecting the resistance of phytophthora melonis to the CAA bactericides, provided by the invention, is simple and rapid, high in sensitivity and good in stability, can effectively monitor and early warn the development trend of the resistance of the field phytophthora melonis to the CAA bactericides, and can guide the formulation of a scientific disease management strategy to delay and control the further development of the drug resistance.
Owner:CHINA AGRI UNIV

Alternaria solani loop-mediated amplification detection primer and detection method thereof

The invention discloses an alternaria solani loop-mediated amplification detection primer and a detection method thereof. The primer and the detection method are special for the specific detection ofthe alternaria solani. Alternaria solani loop-mediated amplification primers F3, B3, FIP and BIP are mainly used; after the color reaction or agarose gel electrophoresis detection is conducted after loop-mediated isothermal amplification, green fluorescence or a loop-mediated amplification characteristic trapezoidal band can be observed. The loop-mediated amplification primers and the usage can beused for rapid sensitive accurate detection of plants infected with the alternaria solani in production practices, and can also be used for early diagnosis of field diseases and monitoring and identification of pathogens to provide reliable technical and theoretical basis for prevention and control of the alternaria solani.
Owner:INST OF PLANT PROTECTION FAAS

LAMP detection primer for sweet potato blast fungus and visual detection method of sweet potato blast fungus

The invention provides a LAMP detection primer for sweet potato blast fungus and a visual detection method of the blast fungus, wherein a group of LAMP primers F3, B3, FIP and BIP of sweet potato blast fungus are mainly designed; LAMP is used for constant temperature amplification; after the amplification reaction, chromogenic reaction or agarose gel electrophoresis detection can be performed to directly and visually observe characteristics of ladder patterns in fluorescent green or electrophoresis. Loop-mediated isothermal amplification technology established by the invention for the sweet potato blast fungus can realize rapid detection of the sweet potato blast fungus in diseased tissues (plants and potato pieces), has advantages of rapid amplification, high efficiency, good specificityand convenient operation, no need of special instruments, and provides a reliable technical basis for prevention and control of the sweet potato blast fungus.
Owner:漳浦县六鳌全域有限公司

Phytophthora vignae LAMP (loop-mediated isothermal amplification) detection primers and phytophthora vignae LAMP detection method

The invention discloses phytophthora vignae LAMP (loop-mediated isothermal amplification) detection primers and a phytophthora vignae LAMP detection method which are specially applied to specific detection of phytophthora vignae. The phytophthora vignae LAMP primers are mainly adopted and designed, and green fluorescence can be observed or an LAMP characteristic ladder can appear through the chromogenic reaction or agarose gel electrophoresis detection after LAMP. The LAMP primers and a usage method thereof can be applied to rapid, sensitive and accurate detection of the cowpea diseases in production practice, can also be applied to early diagnosis of diseases in fields as well as monitoring and identification of germs, and provide reliable technical and theoretical bases for control of the cowpea diseases.
Owner:INST OF PLANT PROTECTION FAAS

Molecule primer for detecting javanese root knot nematode and usage

A molecular detecting primer for meloidogyne features that three pairs of PCR primers, MI-FIR, MJ-F / R and MI-F / MT-R are designed for the southrn, Jawa and peanut meloidogynes, which can be specifically amplified respectively on southern, Jawa and peanut meloidogynes to obtain the amplified 955 bp, 517 bp and 799 bp products respectively. They can be used to quickly and reliably detect and verify said meloidogynes.
Owner:NANJING AGRICULTURAL UNIVERSITY

Method for identifying helix pomatia by PCR (polymerase chain reaction) detection

The invention discloses a method for identifying helix pomatia by PCR (polymerase chain reaction) detection, which uses specific primers to identify molecular characteristics of helix pomatia. The forward primer for the PCR reaction is HP-(P1): 5'-TTCGTTGAGAGTTAGG-3', and the reverse primer is HP-(P2): 5'-ATAGTAATAGCACCAGC-3'. The total volume of the PCR reaction system is 25 mu L, wherein the 2*TaqPCRMasterMix is 12.5 mu L, the forward and reverse primers are respectively 0.5 mu L, the DNA (deoxyribonucleic acid) template is 2 mu L, and the rest is sterilized ddH2O. The PCR reaction process comprises the following steps: pre-denaturating at 5 DEG C for 5 minutes; treating at 95 DEG C for 30 seconds, 45 DEG C for 30 seconds and 72 DEG C for 1 minute, and repeating 30 times; and extending at 72 DEG C for 10 minutes, and finishing the reaction. The method disclosed by the invention can quickly and accurately detect and identify helix pomatia. The invention provides a new technical means for detection and identification of helix pomatia in the Catalogue of Quarantine Pest for Import Plants to the People's Republic of China, and has important meanings for preventing helix pomatia from spreading and diffusion.
Owner:INSPECTION & QUARANTINE TECH CENT OF FUJIAN ENTRY EXIT INSPECTION & QUARANTINE BUREAU

Phytophthora capsici LAMP (Loop-mediated isothermal Amplification) primer and rapid detection method thereof

The invention discloses a Phytophthora capsici LAMP primer and a rapid detection method thereof, which are specially used for the specific detection of Phytophthora capsici. Mainly designed a LAMP primer (F3, B3, FIP, BIP) of Phytophthora capsici, using this primer for constant temperature amplification and adding 50μM Calcein-500μM MnCl2 color reagent or agarose gel electrophoresis detection, it can be observed to green fluorescence or a trapezoidal band characteristic of LAMP. The present invention can be used for rapid, sensitive and accurate detection of Phytophthora capsici in plants and soil infected by Phytophthora capsici in production practice, and can be used for early diagnosis of field diseases and monitoring and identification of pathogens. Provide reliable technical and theoretical basis for disease control.
Owner:INST OF PLANT PROTECTION FAAS

A kind of lamp detection primer of sweet potato blast fungus and its visual detection method

The present invention provides a kind of LAMP detection primer of sweet potato Pyrogenic diosminum and its visual detection method, mainly designs a group of LAMP primers F3, B3, FIP, BIP of sweet potato Pyrogenic diosminum; Utilizes LAMP to amplify at constant temperature, after the amplification reaction, pass Chromogenic reaction or agarose gel electrophoresis detection, the fluorescent green or the characteristics of the trapezoidal band during electrophoresis can be directly observed with the naked eye. The loop-mediated isothermal amplification technology established by the present invention for Pyrophthora japonica in sweet potato can realize the rapid detection of Pyrophila potato in diseased tissues (plants, potato pieces), and has the advantages of rapid amplification, high efficiency, good specificity, and easy operation , No need for special equipment and other advantages, providing a reliable technical basis for the control of sweet potato blast fungus.
Owner:漳浦县六鳌全域有限公司

A kind of detection primer of potato infestans lamp and its visual detection method

The invention discloses a LAMP detection primer for potato infestans and a visual detection method thereof, which are specially used for specific detection of potato infestans. The LAMP primers F3, B3, FIP, and BIP of a potato infestans were mainly designed. After the chromogenic reaction or agarose gel electrophoresis detection after the constant temperature amplification of LAMP, green fluorescence or the characteristic ladder-shaped band of LAMP can be observed. The invented LAMP primers and their usage can be used for rapid, sensitive and accurate detection of plants infected by P. Provide reliable technical and theoretical basis for the prevention and treatment of the disease.
Owner:INST OF PLANT PROTECTION FAAS

Primer group utilizing LAMP technology to detect witloof pseudomonas and kit and method

The invention discloses a primer group utilizing an LAMP technology to detect witloof pseudomonas and a kit and a method. The primer group includes a pair of outer-side primers F3 and B3 and a pair of inner-side primers FIP and BJP, and sequences are respectively shown as SEQ IDNO.1-4. The kit includes the primer group and can also include other detection reagents. The method utilizing the LAMP technology to detect the witloof pseudomonas comprises the steps that a genome DNA of a sample to be tested is used as a template, and LAMP amplification reaction is performed by utilizing the primer group or the kit; after the reaction, the color change of an LAMP amplification reaction solution is observed, if the reaction solution is a green troubled solution, the reaction is regarded as positive reaction; if the reaction solution is an orange transparent solution, the reaction is regarded as negative reaction. The primer group has the following advantages that a result is reliable, the specificity is strong, the sensitivity is high, and the primer group is fast and efficient and simple, convenient and easy to operate.
Owner:PLANT PROTECTION RES INST OF GUANGDONG ACADEMY OF AGRI SCI

A method for detecting and identifying Mediterranean white snails by PCR

The invention discloses a method for detecting and identifying the Mediterranean white snail by PCR. The method uses specific primers to identify the molecular characteristics of the Mediterranean white snail; the upstream primer of the PCR reaction is HP-(P1):5'-? GTTATTGTTACTGCTCACGC? -3', the downstream primer is HP-(P2): 5'-? CTGCTAAGACAGGGAGAGAT? -3'. The total volume of the PCR reaction system is 25 μL, in which 2×Taq? PCR? MasterMix? 12.5 μL, 0.5 μL of upstream and downstream primers, 3 μL of DNA template, and the rest was supplemented with sterilized ddH2O; the PCR reaction program was: 94 °C pre-denaturation for 5 min; 30s, 46°C? 30s, 72°C? 1 min, 25 cycles; 72 ° C extension for 10 min, the end of the reaction. The method of the invention can quickly and accurately detect and identify the Mediterranean white snail. The invention provides a new technical means for the detection and identification of the Mediterranean white snail in the List of Imported Plant Quarantine Pests of the People's Republic of China, and is of great significance for preventing the spread and spread of the Mediterranean white snail.
Owner:INSPECTION & QUARANTINE TECH CENT OF FUJIAN ENTRY EXIT INSPECTION & QUARANTINE BUREAU

A method for pcr detection and identification of loose large snails

The invention discloses a method for detecting and identifying Helix aspersa MUller through PCR (polymerase chain reaction). The method comprises the step of identifying the molecular feature of the Helix aspersa MUller by using specific primers, wherein the upstream primer of PCR is HP-(P1): 5'-ACTCTTTGGTATTTGATGCG-3', and the downstream primer is HP-(P2): 5'-ACCTGCTAAAACGGGTAATG-3'. The method can be used for quickly and accurately detecting and identifying the Helix aspersa MUller. The method provides a new technical means for detection and identification of the Helix aspersa MUller in Imported Plant Quarantine Pest Directory of the People's Republic of China, and has significance for preventing the propagation and diffusion of the Helix aspersa MUller.
Owner:INSPECTION & QUARANTINE TECH CENT OF FUJIAN ENTRY EXIT INSPECTION & QUARANTINE BUREAU

Loop-mediated amplification detection primer and detection method for potato early blight

The invention discloses a loop-mediated amplification detection primer and a visual detection method for potato early blight bacteria, which are specially used for specific detection of potato early blight bacteria. The loop-mediated amplification primers F3, B3, FIP, and BIP of a kind of potato early blight bacteria are mainly used. After the loop-mediated constant temperature amplification, the color reaction or agarose gel electrophoresis detection, green fluorescence or rings can be observed. Mediated amplification of the characteristic ladder-shaped band. The invented loop-mediated amplification primer and its usage can be used for rapid, sensitive and accurate detection of plants infected by Potato blight infestation in production practice, and can be used for early diagnosis of field diseases and monitoring and identification of pathogens, Provide reliable technical and theoretical basis for the control of potato early blight.
Owner:INST OF PLANT PROTECTION FAAS

Cucumber phytophthora LAMP (Loop-mediated Isothermal Amplification) primer and rapid detection method thereof

The invention discloses cucumber phytophthora LAMP (Loop-mediated Isothermal Amplification) primer and a rapid detection method thereof, which are specifically used for the specific detection of cucumber phytophthora. The rapid detection method is characterized in that a cucumber phytophthora LAMP primer is mainly adopted and designed, detailed information can be seen in SEQ NO.1-SEQ NO.4. Green fluorescent light or an LAMP characterized ladder-shaped pattern can be observed through the LAMP and the color developing by adding an SYBR green I color agent for developing color or the agarose gel electrophoresis detection. The LAMP primer and the rapid detection method, which are disclosed by the invention, can be used for quickly, sensitively and accurately detecting the cucumber phytophthora in plants and soil which are affected by the cucumber phytophthora in production practice and can be simultaneously used for the early diagnosis of diseases in filed and the monitoring and the identification of germs, and reliable technical and theoretical basis is provided for preventing the disease caused by the cucumber phytophthora.
Owner:INST OF PLANT PROTECTION FAAS

Primers for detection of Phytophthora cowpea lamp and its detection method

The invention discloses phytophthora vignae LAMP (loop-mediated isothermal amplification) detection primers and a phytophthora vignae LAMP detection method which are specially applied to specific detection of phytophthora vignae. The phytophthora vignae LAMP primers are mainly adopted and designed, and green fluorescence can be observed or an LAMP characteristic ladder can appear through the chromogenic reaction or agarose gel electrophoresis detection after LAMP. The LAMP primers and a usage method thereof can be applied to rapid, sensitive and accurate detection of the cowpea diseases in production practice, can also be applied to early diagnosis of diseases in fields as well as monitoring and identification of germs, and provide reliable technical and theoretical bases for control of the cowpea diseases.
Owner:INST OF PLANT PROTECTION FAAS

LAMP (Loop-Mediated Isothermal Amplification) primer of phytophthora nicotianae and fast detection method thereof

The invention discloses an LAMP (Loop-Mediated Isothermal Amplification) primer of phytophthora nicotianae and a fast detection method thereof, which are especially used for specific detection of the phytophthora nicotianae. The LAMP primer adopted and designed is F3, B3, FIP and BIP, and the sequence of the LAMP primer is shown in SEQIDNO.1-4. Green fluorescence can be observed or the ladder pattern of LAMP characteristic occurs by isothermal amplification and addition of SYBRgreenI color-developing agent for color development or sepharose for gel-electrophoresis detection. The LAMP primer and the use method can be used for fast, sensitive and accurate detection of the phytophthora nicotianae in plants and soil infected by the phytophthora nicotianae in production practice, simultaneously can be used for early diagnosis of diseases in the field and monitoring and identification of germs, and provide reliable technical and theoretical basis for controlling the diseases caused by the phytophthora nicotianae.
Owner:INST OF PLANT PROTECTION FAAS

Aspergillus flavus LAMP (loop-mediated isothermal amplification) detection primer and visualized detection method thereof

The invention discloses an aspergillus flavus LAMP (loop-mediated isothermal amplification) detection primer and a visualized detection method of the aspergillus flavus LAMP detection primer, which are specially used for specific detection of aspergillus flavus. The invention mainly designs one aspergillus flavus LAMP detection primer (comprising a pair of outer side primers and one pair of inner side primers); green fluorescence or a trapezoidal zone with an LAMP characteristic can be observed by carrying out isothermal amplification and adding a 50micronM Calcein-500micronM MnCl2 developing agent to develop or carrying out agarose gel electrophoresis detection. The aspergillus flavus LAMP detection primer and the visualized detection method of the aspergillus flavus LAMP detection primer can be used for visualized detection of aspergillus flavus in crops including peanuts, corns and the like which are infected by the aspergillus flavus in production practices, and can also be used for early diagnosis, monitoring and identification of bacteria in tissues of the peanuts or the corns which are naturally attacked.
Owner:INST OF PLANT PROTECTION FAAS
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More