Method for rapidly identifying resistance of phytophthora melonis to CAA bactericides and special primer

A drug-resistant and melon technology, applied in the field of molecular biology, can solve the problems of large workload, long detection period, low detection sensitivity, etc., and achieve the effects of long period, guaranteed result reliability, and large workload.

Inactive Publication Date: 2013-01-16
CHINA AGRI UNIV
View PDF0 Cites 4 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, these methods all need to measure the EC of the agent to the pathogenic bacteria. 50 To compare the differences between sensitive and resistant strains, the test requires multiple treatments and multiple repetitions, so the detection cycle is long, the workload is heavy, and more human resources and materials are consumed
Moreover, the detection sensitivity of the above-mentioned conventional methods is low, and the mutation frequency of drug-resistant strains can only be detected when it is above 1%.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for rapidly identifying resistance of phytophthora melonis to CAA bactericides and special primer
  • Method for rapidly identifying resistance of phytophthora melonis to CAA bactericides and special primer
  • Method for rapidly identifying resistance of phytophthora melonis to CAA bactericides and special primer

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0030] Embodiment 1, Phytophthora cucurbitus is to the sensitivity determination of CAA fungicides flumorph, dimethomorph and iprocarbam

[0031] Five Phytophthora melonii resistant strains, the strain numbers are F58-4, I63-2, D63-1, F63-11 and D70-3; four Phytophthora melonii sensitive strains, the strain numbers are TX21, TX33 , TJ90 and TJ12.

[0032] Baiyun bean culture medium: 60g of Baiyun bean powder, 7g of agar powder, distilled water to 1L, sterilized by moist heat at 121°C for 20 minutes.

[0033] 1. The experimental steps are as follows:

[0034] 1) flumorph, dimethomorph and iprocarbam were respectively prepared with methanol for 10 5 μg / ml stock solution. For the sensitivity determination of four strains of Phytophthora cucurbitus sensitive strains, flumorph was diluted stepwise to 500 μg / mL, 700 μg / mL, 900 μg / mL, 1.00×10 3 μg / mL, 1.25×10 3 μg / mL, 1.50×10 3 μg / mL concentration gradient, dimethomorph was diluted to 100μg / mL, 150μg / mL, 200μg / mL, 250μg / mL, 300...

Embodiment 2

[0042] Embodiment 2, discovery of CesA3 gene and CesA3 protein mutation site in Phytophthora meloni

[0043] 1. Strains: The resistant strain is F58-4, and the sensitive strain is TX21.

[0044] 2. Method:

[0045] 1) Strain cultivation: culture Phytophthora melonii at 28°C with Baiyun bean culture medium (60g of Baiyun bean powder, 7g of agar powder, distilled water to 1L, 121°C moist heat sterilization for later use). The pre-cultured Phytophthora meloniformis was inoculated on the white cloud bean medium covered with cellophane, cultured in the dark at 28°C for 5 days, the mycelia were collected, frozen in liquid nitrogen and stored at -80°C for genomic DNA extraction.

[0046] 2) Genomic DNA of resistant strains and sensitive strains were extracted respectively.

[0047] 3) PCR amplification of cellulose synthase CesA3 gene

[0048] Primers: PmA3F1 (5'-TCTCGTGTCGGACGGACCAA-3') and PmA3R1 (5'-TCTGCATGTCCAGCCTTCC-3');

[0049] The PCR reaction system is as follows:

[0...

Embodiment 3

[0060] Embodiment 3, the method for detecting mutation site in Phytophthora cucurbita

[0061] 1. Primer design

[0062] The bacterial strain is the bacterial strain used in Example 1.

[0063] Primers are listed in Table 2.

[0064] Table 2. Primers used in PCR detection of Phytophthora cucurbitus strains resistant to CAA fungicides

[0065]

Primers

Sequence(5'-3')

PMF

ATCTACGCTCGCGGTACCAAG (Sequence 1)

PMR1109A

CGAACACCACGATGTACACCAG (Sequence 2)

PMR1109B

CGAACACCACGATGTACACCTG (Sequence 3)

PMR1109C

CGAACACCACGATGTACACCCG (sequence 4)

PMR1109D

CGAACACCACGATGTACACCGG (Sequence 5)

[0066] The PCR reaction system is as follows:

[0067] 50-μl PCR system:

[0068]

[0069] The PCR reaction conditions are as follows:

[0070]

[0071] The result is as figure 1 As shown in A. The results showed that: when the annealing temperature was 68.5°C, the primer pair PMF and PMR1109B could ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a ribonucleotide point mutation method for rapidly identifying the resistance of phytophthora melonis to CAA bactericides and a special primer, and belongs to the technical field of molecular organisms. The specific prier comprises a DNA molecule shown in SEQ ID NO:1 and a DNA molecule shown in SEQ ID NO:3. The molecule detection method for detecting the resistance of phytophthora melonis to the CAA bactericides, provided by the invention, is simple and rapid, high in sensitivity and good in stability, can effectively monitor and early warn the development trend of the resistance of the field phytophthora melonis to the CAA bactericides, and can guide the formulation of a scientific disease management strategy to delay and control the further development of the drug resistance.

Description

technical field [0001] The invention relates to the cloning of Phytophthora meloni cellulose synthase-related gene CesA3 and its application in the monitoring of CAAs fungicide resistance, specifically disclosing a rapid identification of nucleotide point mutations of Phytophthora meloni CesA3 gene and its effect on Molecular detection method and special primers for CAA fungicide resistance. It belongs to the technical field of molecular biology. Background technique [0002] Cucumber blight caused by Phytophthora melonis infecting cucumbers is a common disease in cucumber producing areas in my country, especially in cucumber growing areas in the suburbs of Beijing, Shanghai, Nanjing, Hangzhou and Wuhan. The disease can cause serious losses to cucumber yields, and even reduce yields by 80%. Phytophthora meloni can also infect cucurbit crops, including cucumber, zucchini, cantaloupe, wax gourd, gourd and other crops, causing yield loss. [0003] At present, chemical contro...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68C12N15/11C12N9/10C12N15/54C12R1/645
Inventor刘西莉陈磊朱书生卢晓红庞智黎蔡萌毕扬
OwnerCHINA AGRI UNIV