Method and special primers for fast identifying phytophthora capsici leonian resistance to pyrimorph
A technology of Phytophthora capsici and drug resistance, applied in the field of molecular biology, can solve the problems of long detection cycle, low detection sensitivity, and many human resources and materials, and achieve the effect of delaying further development
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0029] Embodiment 1, Phytophthora capsici are sensitive to pyrimorph
[0030] Three Phytophthora capsici resistant mutants, strain numbers R3-2, R3-3, and R11-1; two Phytophthora capsici sensitive parent strains, strain numbers Hd3 and Hd11 respectively.
[0031] Potato dextrose agar (PDA) medium: 200 g of potatoes, 13 g of agar powder, 18 g of glucose, distilled water to 1 L, sterilized at 121° C. for 20 minutes.
[0032] 1. The experimental steps are as follows:
[0033] 1) Pyramorpholine is prepared into 10 with dimethyl sulfoxide (DMSO) 4 μg / ml stock solution. For the susceptibility determination of Phytophthora capsici sensitive strains, pyrimorph was diluted stepwise to 187.5 μg / mL, 375 μg / mL, 750 μg / mL, 1.5×10 3 μg / mL, 3×10 3 μg / mL, 4×10 3 Concentration gradient of μg / mL; For the sensitivity determination of Phytophthora capsici resistant strains, the test agent fenpyramorph was diluted stepwise to 312.5μg / mL, 625μg / mL, 1.25×10 3 μg / mL, 2.5×10 3 μg / mL, 5×10 3 μg...
Embodiment 2
[0042] Embodiment 2, discovery of CesA3 gene and CesA3 protein mutation site in Phytophthora capsici
[0043] 1. Strains: resistant strains are R3-2, R3-3, R11-1; sensitive strains are Hd3 and Hd11.
[0044] 2. Method:
[0045] 1) Strain cultivation: use PDA medium (200 g of peeled potatoes, 18 g of glucose, 13 g of agar powder, and distilled water to make up to 1 L. 121 ° C, 20 min, after damp heat sterilization) to cultivate Phytophthora capsici at 28 ° C. The pre-cultured Phytophthora capsici sensitive strains were inoculated on PDA medium covered with cellophane, cultured in the dark at 28°C for 5 days, and the hyphae were collected, frozen in liquid nitrogen and stored at -80°C for genomic DNA extraction.
[0046] 2) Genomic DNA of Phytophthora capsici sensitive strains and resistant strains were extracted respectively:
[0047] Take an appropriate amount of mycelium frozen in liquid nitrogen, grind it into powder with a mortar, and place it in a 1.5mL centrifuge tube; ...
Embodiment 3
[0068] Embodiment 3, the method for detecting mutation site in Phytophthora cucurbita
[0069] 1. Primer design
[0070] The bacterial strain is the bacterial strain used in Example 1.
[0071] The primers are shown in Table 2. Allele specific-PCR primers were designed according to the sequence of the mutant cesA3 gene. The last base at the 3'-end of the forward primer RF1077 was consistent with the mutated base. In order to increase the specificity of the primer, reverse The second base at the 3'-end of the primer introduces a mismatched base T (SEQ ID NO: 2); the reverse primer is R1077 (SEQ ID NO: 3).
[0072] Table 2.PCR detection of Phytophthora capsici to the primers used in the resistant strain of fungicide fenpyrimorph
[0073] Primer
Sequence (5'-3')
CF1077 (forward)
GTTCTTCGGGTTCTTCGTAATGAG (sequence 1)
R1077B (forward)
TCTTCGGGTTATTCGTGATGAGTA (sequence 2)
R1077 (reverse)
CGAACACCACGATGTACACCTG (Sequence 3)
[...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap