CRISPR-Cas9-specific method for knocking out porcine PDX1 gene and sgRNA for specifically targeting PDX1 gene

A specific and gene technology, applied in the field of genetic engineering and gene knockout, to achieve the effect of high solution cost and long solution cycle

Active Publication Date: 2021-07-23
THE SECOND PEOPLES HOSPITAL OF SHENZHEN
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the key technical problem of this approach is to design and prepare precisely targeted sgRNA, because the targeting accuracy of genes is highly dependent on the sgRNA target sequence, and whether the precise targeted sgRNA can be successfully designed becomes a key technical issue for knocking out the target gene , the present invention is intended to solve this technical problem so as to provide a solid foundation for knocking out the PDX1 gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • CRISPR-Cas9-specific method for knocking out porcine PDX1 gene and sgRNA for specifically targeting PDX1 gene
  • CRISPR-Cas9-specific method for knocking out porcine PDX1 gene and sgRNA for specifically targeting PDX1 gene
  • CRISPR-Cas9-specific method for knocking out porcine PDX1 gene and sgRNA for specifically targeting PDX1 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0066] Example 1. Selection and design of Sus scrofa (pig) PDX1 gene sgRNA target sequence

[0067] The target sequence determines the targeting specificity of the sgRNA and the efficiency of inducing Cas9 to cleave the target gene. Therefore, efficient and specific target sequence selection and design are the prerequisites for constructing sgRNA expression vectors.

[0068] 1. Selection of sgRNA target sequence for PDX1 gene

[0069] For the PDX1 gene, the following principles should be followed in the selection of target sequences:

[0070] (1) Find the target sequence conforming to the 5'-N(20)NGG-3' rule in the exon coding region of the PDX1 gene, where N(20) represents 20 consecutive bases, and each N represents A or T Or C or G, the target sequence that meets the above rules is located on the sense strand or the antisense strand;

[0071] (2) Select the first exon coding region sequence near the N-terminus, the target sequence can be located in the first exon coding r...

Embodiment 2

[0086] Example 2: Construction of sgRNA expression vector for PDX1 gene

[0087] 1. Synthesis of DNA Inserts

[0088] (1) Synthesize the forward and reverse oligonucleotide sequences designed above

[0089] The oligonucleotide sequence can be specifically synthesized by a commercial company (such as Invitrogen) according to the provided sequence. In this example and the following examples, the effect of the target sequences listed in the No. 3 and No. 10 sequences listed in Table 1 on the knockout effect of the PDX1 gene was studied.

[0090] The forward oligonucleotide sequence and reverse oligonucleotide sequence corresponding to No. 3 target sequence are as follows:

[0091] CACCGCCCCCTGCGTGCCTGTACAT (SEQ ID NO: 22);

[0092]AAACATGTACAGGCACGCAGGGGGC (SEQ ID NO: 23).

[0093] The forward oligonucleotide sequence and reverse oligonucleotide sequence corresponding to No. 10 target sequence are as follows:

[0094] CACCGGCCCATGTACAGGCACGCAG (SEQ ID NO: 24);

[0095] AAAC...

Embodiment 3

[0131] Example 3. Obtaining a pseudotyped lentivirus expressing PDX1sgRNA

[0132] 1. Material preparation

[0133] Amplify and extract packaging plasmids pLP1, pLP2, and pLP / VSVG (purchased from Invitrogen, whose maps are shown in figure 2 , image 3 and Figure 4 shown); amplify and extract vector plasmid lentiCRISPR v2-PDX1; culture packaging cell line HEK293T cells (purchased from ATCC); DMEM medium, Opti-MEM medium and fetal bovine serum FBS (purchased from Gibco); Lipofectamine2000 ( purchased from Invitrogen); HEK293T cells were cultured in 5% CO 2 In the culture environment of 37°C, the culture medium is DMEM medium containing 10% FBS.

[0134] 2. Transfection and Viral Packaging

[0135] Day 1: Passage the packaging cell line HEK293T to a 10cm dish, about 30% confluence;

[0136] The next day: when HEK293T reaches 80% confluence, transfect according to the following recipe:

[0137] Prepare Mixture 1, containing:

[0138] lentiCRISPR v2-PDX1: 6 μg

[0139] p...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for specifically knocking out pig PDX1 gene by using CRISPR-Cas9 and sgRNA for specifically targeting PDX1 gene. The target sequence of the sgRNA specifically targeting the PDX1 gene of the present invention on the PDX1 gene conforms to the sequence arrangement rule of 5'-N(20)NGG-3', wherein N(20) represents 20 consecutive bases, wherein each N represents A or T or C or G; the target sequence on the PDX1 gene is located in the first exon coding region of the N-terminal of the PDX1 gene or at the junction with the adjacent intron; the target sequence on the PDX1 gene only one. The sgRNA of the present invention is used in the method of CRISPR-Cas9 to specifically knock out the porcine PDX1 gene, which can quickly, accurately, efficiently and specifically knock out the porcine PDX1 gene, effectively solving the long period and high cost of constructing PDX1 knockout pigs The problem.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to the technical field of gene knockout, in particular to a method for specifically knocking out pig PDX1 gene by CRISPR-Cas9 and an sgRNA for specifically targeting PDX1 gene. Background technique [0002] Organ transplantation is the most effective treatment for diseases of organ failure. So far, nearly one million patients around the world have extended their lives through organ transplantation. With the aging of the population and the advancement of medical technology, more and more patients need organ transplantation, but the shortage of donor organs seriously restricts the development of organ transplantation. Taking kidney transplantation as an example, as many as 300,000 patients need kidney transplantation in my country every year, but no more than 10,000 donated kidneys can be used for transplantation, and most patients die of kidney failure. Relying on organ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C12N15/113C12N15/867
CPCC12N15/113C12N15/86C12N2310/10C12N2740/15045C12N2810/10
Inventor蔡志明牟丽莎谢崇伟陈鹏飞张军方陆赢高汉超刘璐
OwnerTHE SECOND PEOPLES HOSPITAL OF SHENZHEN