CRISPR-Cas9-specific method for knocking out porcine CMah gene and sgRNA for specifically targeting CMah gene
A specific and genetic technology, applied in the field of gene knockout and genetic engineering, can solve the problems of low recombination efficiency, tedious work, time-consuming, low efficiency, etc., and achieve the effect of high cost and long solution cycle
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Publication Date
- 2020-11-24
Smart Images

Figure 1 
Figure 2 
Figure 3
Abstract
Description
technical field
[0001] The invention relates to the technical field of genetic engineering, in particular to the technical field of gene knockout, in particular to a CRISPR-Cas9 method for specifically knocking out the pig CMAH gene and an sgRNA for specifically targeting the CMAH gene. Background technique
[0002] Organ transplantation is the most effective treatment for diseases of organ failure. So far, nearly one million patients around the world have extended their lives through organ transplantation. With the aging of the population and the advancement of medical technology, more and more patients need organ transplantation, but the shortage of donor organs seriously restricts the development of organ transplantation. Taking kidney transplantation as an example, as many as 300,000 patients need kidney transplantation in my country every year, but no more than 10,000 donated kidneys can be used for transplantation, and most patients die of kidney failure. Relying on ...
Examples
Embodiment 1
[0067] Example 1, Selection and design of Sus scrofa (pig) CMAH gene sgRNA target sequence
[0068] The target sequence determines the targeting specificity of the sgRNA and the efficiency of inducing Cas9 to cleave the target gene. Therefore, efficient and specific target sequence selection and design are the prerequisites for constructing sgRNA expression vectors.
[0069] 1. Selection of sgRNA target sequence for CMAH gene
[0070] For the CMAH gene, the following principles should be followed in the selection of target sequences:
[0071] (1) Find the target sequence in the exon coding region of the CMAH gene that conforms to the 5'-N(20)NGG-3' rule, where N(20) represents 20 consecutive bases, and each N represents A or T Or C or G, the target sequence that meets the above rules is located on the sense strand or the antisense strand;
[0072] (2) Select the 5 exon coding region sequences near the N-terminus, the target sequence can be located in the 5 exon coding regio...
Embodiment 2
[0088] Embodiment 2, constructing the sgRNA expression vector of CMAH gene
[0089] 1. Synthesis of DNA Inserts
[0090] (1) Synthesize the forward and reverse oligonucleotide sequences designed above
[0091] The oligonucleotide sequence can be specifically synthesized by a commercial company (such as Invitrogen) according to the provided sequence. In this example and the following examples, the effect of the target sequences listed in the No. 2 and No. 4 sequences listed in Table 1 on the knockout effect of the CMAH gene was studied.
[0092] The forward oligonucleotide sequence and reverse oligonucleotide sequence corresponding to No. 2 target sequence are as follows:
[0093] CACCGTTGAGATTGGCAGCTTCGGC (SEQ ID NO: 63);
[0094] AAACGCCGAAGCTGCCAATCTCAAC (SEQ ID NO: 64).
[0095] The forward oligonucleotide sequence and reverse oligonucleotide sequence corresponding to No. 4 target sequence are as follows:
[0096] CACCGTGCCGAAGCTGCCAATCTCA (SEQ ID NO: 65);
[0097] AA...
Embodiment 3
[0133] Example 3. Obtaining a pseudotyped lentivirus expressing CMAH sgRNA
[0134] 1. Material preparation
[0135] Amplify and extract packaging plasmids pLP1, pLP2, and pLP / VSVG (purchased from Invitrogen, whose maps are shown in figure 2 , image 3 and Figure 4 shown); amplify and extract vector plasmid lentiCRISPR v2-CMAH; culture packaging cell line HEK293T cells (purchased from ATCC); DMEM medium, Opti-MEM medium and fetal bovine serum FBS (purchased from Gibco); Lipofectamine2000 ( purchased from Invitrogen); HEK293T cells were cultured in 5% CO 2 In the culture environment of 37°C, the culture medium is DMEM medium containing 10% FBS.
[0136] 2. Transfection and Viral Packaging
[0137] Day 1: Passage the packaging cell line HEK293T to a 10cm dish, about 30% confluence;
[0138] The next day: when HEK293T reaches 80% confluence, transfect according to the following recipe:
[0139] Prepare Mixture 1, containing:
[0140] lentiCRISPR v2-CMAH: 6 μg
[0141] ...