Method for CRISPR-Cas9 specific knockout of pig GGTA1 gene and sgRNA for specific targeted GGTA1 gene

A specific and genetic technology, applied in the field of genetic engineering and gene knockout, to achieve the effect of high cost and long solution period

Inactive Publication Date: 2016-04-13
THE SECOND PEOPLES HOSPITAL OF SHENZHEN
View PDF1 Cites 42 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

However, the key technical problem of this approach is to design and prepare precisely targeted sgRNA, because the targeting accuracy of genes is highly dependent on the sgRNA target sequence, and whether the precise targeted sgRNA can be successfully designed becomes a key technical issue for knocking out the target gene , the present invention is intended to solve this technical problem so as to provide a solid foundation for knocking out the GGTA1 gene

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Method for CRISPR-Cas9 specific knockout of pig GGTA1 gene and sgRNA for specific targeted GGTA1 gene
  • Method for CRISPR-Cas9 specific knockout of pig GGTA1 gene and sgRNA for specific targeted GGTA1 gene
  • Method for CRISPR-Cas9 specific knockout of pig GGTA1 gene and sgRNA for specific targeted GGTA1 gene

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0067] Example 1, Selection and design of Susscrofa (pig) GGTA1 gene sgRNA target sequence

[0068] The target sequence determines the targeting specificity of the sgRNA and the efficiency of inducing Cas9 to cleave the target gene. Therefore, efficient and specific target sequence selection and design are the prerequisites for constructing sgRNA expression vectors.

[0069] 1. Selection of sgRNA target sequence for GGTA1 gene

[0070] For the GGTA1 gene, the following principles should be followed in the selection of target sequences:

[0071] (1) Find the target sequence conforming to the 5'-N(20)NGG-3' rule in the exon coding region of the GGTA1 gene, where N(20) represents 20 consecutive bases, and each N represents A or T Or C or G, the target sequence that meets the above rules is located on the sense strand or the antisense strand;

[0072] (2) Select the 5 exon coding region sequences near the N-terminal, the target sequence can be located in the 5 exon coding regio...

Embodiment 2

[0088] Example 2: Construction of the sgRNA expression vector of the GGTA1 gene

[0089] 1. Synthesis of DNA Inserts

[0090] (1) Synthesize the forward and reverse oligonucleotide sequences designed above

[0091] The oligonucleotide sequence can be specifically synthesized by a commercial company (such as Invitrogen) according to the provided sequence. In this example and the following examples, the knockout effect of the target sequence shown in the No. 1 sequence listed in Table 1 on the GGTA1 gene was studied.

[0092] The forward oligonucleotide sequence and reverse oligonucleotide sequence corresponding to No. 1 target sequence are as follows:

[0093] CACCGGCTGCTTGTCTCAACTGTAA (SEQ ID NO: 40);

[0094] AAACTTACAGTTGAGACAAGCAGCC (SEQ ID NO: 41).

[0095] The corresponding forward and reverse oligonucleotide sequences are annealed and annealed to form double-stranded DNA fragments with cohesive ends.

[0096] The reaction system (20μL) is as follows:

[0097] Forwa...

Embodiment 3

[0130] Example 3. Obtaining a pseudotyped lentivirus expressing GGTA1 sgRNA

[0131] 1. Material preparation

[0132] Amplify and extract packaging plasmids pLP1, pLP2, and pLP / VSVG (purchased from Invitrogen, whose maps are shown in figure 2 , image 3 and Figure 4 shown); amplify and extract vector plasmid lentiCRISPRv2-GGTA1; culture packaging cell line HEK293T cells (purchased from ATCC); DMEM medium, Opti-MEM medium and fetal bovine serum FBS (purchased from Gibco); Lipofectamine2000 (purchased from from Invitrogen); HEK293T cells were cultured in 5% CO 2 In the culture environment of 37°C, the culture medium is DMEM medium containing 10% FBS.

[0133] 2. Transfection and Viral Packaging

[0134] Day 1: Passage the packaging cell line HEK293T to 10cmdish, about 30% confluence;

[0135] The next day: when HEK293T reaches 80% confluence, transfect according to the following recipe:

[0136] Prepare Mixture 1, containing:

[0137] lentiCRISPRv2-GGTA1: 6 μg

[0138...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a method for CRISPR-Cas9 specific knockout of a pig GGTA1 gene and sgRNA for a specific targeted GGTA1 gene. The target sequence of the sgRNA for the specific targeted GGTA1 gene on the GGTA1 gene is in accordance with the sequence arrangement rule of 5'-N(20)NGG-3', wherein N(20) represents 20 continuous bases, and each N represents A or T ot C or G; the target sequence on the GGTA1 gene is positioned at a junction of 5 exon coding areas and / or adjacent introns of the N-end of the GGTA1 gene; and the target sequence on the GGTA1 gene is unique. According to the method for CRISPR-Cas9 specific knockout of the pig GGTA1 gene via sgRNA, specific knockout of the pig GGTA1 gene can be rapidly and accurately realized with high efficiency, and the problems of long period and high cost for constructing the knockout of the pig GGTA1 gene can be effectively solved.

Description

technical field [0001] The invention relates to the technical field of genetic engineering, in particular to the technical field of gene knockout, in particular to a method for specifically knocking out the pig GGTA1 gene by CRISPR-Cas9 and an sgRNA for specifically targeting the GGTA1 gene. Background technique [0002] Organ transplantation is the most effective treatment for diseases of organ failure. So far, nearly one million patients around the world have extended their lives through organ transplantation. With the aging of the population and the advancement of medical technology, more and more patients need organ transplantation, but the shortage of donor organs seriously restricts the development of organ transplantation. Taking kidney transplantation as an example, as many as 300,000 patients need kidney transplantation in my country every year, but no more than 10,000 donated kidneys can be used for transplantation, and most patients die of kidney failure. Relyin...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/113C12N15/867
CPCC12N15/1137C12N15/86C12N2310/10C12N2740/15045C12N2810/10C12N15/113
Inventor蔡志明牟丽莎谢崇伟张军方陆赢刘璐高汉超陈鹏飞
OwnerTHE SECOND PEOPLES HOSPITAL OF SHENZHEN