Method for CRISPR-Cas9 specific knockout of pig GGTA1 gene and sgRNA for specific targeted GGTA1 gene

A specific and genetic technology, applied in the field of genetic engineering and gene knockout, to achieve the effect of high cost and long solution period

CN105492609AInactive Publication Date: 2016-04-13THE SECOND PEOPLES HOSPITAL OF SHENZHEN
1 Cites 42 Cited by

Patent Information

Authority / Receiving Office
CN · China
Patent Type
Applications(China)
Current Assignee / Owner
Publication Date
2016-04-13
Estimated Expiration
Not applicable · inactive patent

Smart Images

  • Figure 1
    Figure 1
  • Figure 2
    Figure 2
  • Figure 3
    Figure 3
Patent Text Reader

Abstract

The invention discloses a method for CRISPR-Cas9 specific knockout of a pig GGTA1 gene and sgRNA for a specific targeted GGTA1 gene. The target sequence of the sgRNA for the specific targeted GGTA1 gene on the GGTA1 gene is in accordance with the sequence arrangement rule of 5'-N(20)NGG-3', wherein N(20) represents 20 continuous bases, and each N represents A or T ot C or G; the target sequence on the GGTA1 gene is positioned at a junction of 5 exon coding areas and / or adjacent introns of the N-end of the GGTA1 gene; and the target sequence on the GGTA1 gene is unique. According to the method for CRISPR-Cas9 specific knockout of the pig GGTA1 gene via sgRNA, specific knockout of the pig GGTA1 gene can be rapidly and accurately realized with high efficiency, and the problems of long period and high cost for constructing the knockout of the pig GGTA1 gene can be effectively solved.
Need to check novelty before this filing date? Find Prior Art

Description

technical field

[0001] The invention relates to the technical field of genetic engineering, in particular to the technical field of gene knockout, in particular to a method for specifically knocking out the pig GGTA1 gene by CRISPR-Cas9 and an sgRNA for specifically targeting the GGTA1 gene. Background technique

[0002] Organ transplantation is the most effective treatment for diseases of organ failure. So far, nearly one million patients around the world have extended their lives through organ transplantation. With the aging of the population and the advancement of medical technology, more and more patients need organ transplantation, but the shortage of donor organs seriously restricts the development of organ transplantation. Taking kidney transplantation as an example, as many as 300,000 patients need kidney transplantation in my country every year, but no more than 10,000 donated kidneys can be used for transplantation, and most patients die of kidney failure. Relyin...

Examples

Embodiment 1

[0067] Example 1, Selection and design of Susscrofa (pig) GGTA1 gene sgRNA target sequence

[0068] The target sequence determines the targeting specificity of the sgRNA and the efficiency of inducing Cas9 to cleave the target gene. Therefore, efficient and specific target sequence selection and design are the prerequisites for constructing sgRNA expression vectors.

[0069] 1. Selection of sgRNA target sequence for GGTA1 gene

[0070] For the GGTA1 gene, the following principles should be followed in the selection of target sequences:

[0071] (1) Find the target sequence conforming to the 5'-N(20)NGG-3' rule in the exon coding region of the GGTA1 gene, where N(20) represents 20 consecutive bases, and each N represents A or T Or C or G, the target sequence that meets the above rules is located on the sense strand or the antisense strand;

[0072] (2) Select the 5 exon coding region sequences near the N-terminal, the target sequence can be located in the 5 exon coding regio...

Embodiment 2

[0088] Example 2: Construction of the sgRNA expression vector of the GGTA1 gene

[0089] 1. Synthesis of DNA Inserts

[0090] (1) Synthesize the forward and reverse oligonucleotide sequences designed above

[0091] The oligonucleotide sequence can be specifically synthesized by a commercial company (such as Invitrogen) according to the provided sequence. In this example and the following examples, the knockout effect of the target sequence shown in the No. 1 sequence listed in Table 1 on the GGTA1 gene was studied.

[0092] The forward oligonucleotide sequence and reverse oligonucleotide sequence corresponding to No. 1 target sequence are as follows:

[0093] CACCGGCTGCTTGTCTCAACTGTAA (SEQ ID NO: 40);

[0094] AAACTTACAGTTGAGACAAGCAGCC (SEQ ID NO: 41).

[0095] The corresponding forward and reverse oligonucleotide sequences are annealed and annealed to form double-stranded DNA fragments with cohesive ends.

[0096] The reaction system (20μL) is as follows:

[0097] Forwa...

Embodiment 3

[0130] Example 3. Obtaining a pseudotyped lentivirus expressing GGTA1 sgRNA

[0131] 1. Material preparation

[0132] Amplify and extract packaging plasmids pLP1, pLP2, and pLP / VSVG (purchased from Invitrogen, whose maps are shown in figure 2 , image 3 and Figure 4 shown); amplify and extract vector plasmid lentiCRISPRv2-GGTA1; culture packaging cell line HEK293T cells (purchased from ATCC); DMEM medium, Opti-MEM medium and fetal bovine serum FBS (purchased from Gibco); Lipofectamine2000 (purchased from from Invitrogen); HEK293T cells were cultured in 5% CO 2 In the culture environment of 37°C, the culture medium is DMEM medium containing 10% FBS.

[0133] 2. Transfection and Viral Packaging

[0134] Day 1: Passage the packaging cell line HEK293T to 10cmdish, about 30% confluence;

[0135] The next day: when HEK293T reaches 80% confluence, transfect according to the following recipe:

[0136] Prepare Mixture 1, containing:

[0137] lentiCRISPRv2-GGTA1: 6 μg

[0138...