Check patentability & draft patents in minutes with Patsnap Eureka AI!

Construction and identification of Mycobacterium tuberculosis CFP10-38kD-19kD fusion protein

A fusion protein, the technology of Mycobacterium tuberculosis, which is applied in the field of construction of triple recombinant fusion protein of Mycobacterium tuberculosis to achieve the effect of strong specificity and high sensitivity

Inactive Publication Date: 2016-10-26
WANLEI LIFE SCISHENYANG CO LTD
View PDF0 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are few reports on the 19kD fusion protein at home and abroad. Therefore, in this study, based on the advantages of CFP10, 38kD, and 19kD in the serological detection of tuberculosis, the CFP10-38kD-19kD triple fusion protein was constructed by using genetic engineering technology. Diafiltration technology has prepared a serological detection kit, which is expected to provide a more specific and accurate tool for the diagnosis of tuberculosis infection

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Construction and identification of Mycobacterium tuberculosis CFP10-38kD-19kD fusion protein
  • Construction and identification of Mycobacterium tuberculosis CFP10-38kD-19kD fusion protein
  • Construction and identification of Mycobacterium tuberculosis CFP10-38kD-19kD fusion protein

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0020] Example 1: Preparation and purification of Mycobacterium tuberculosis CFP10-38kD-19kD recombinant fusion protein

[0021] 1.1 Gene Fusion

[0022] The complete genome sequence of TB H37Rv was analyzed by computer, and the DNA sequences of its strong epitope CFP10 (GENEBANK locus: NP_218391), 38kD protein (GENEBANK locus: HG813240) and 19kD (GENEBANK locus: CP007027) were selected as templates, and the amplification primers were designed as :

[0023] CFP10 amplification primers:

[0024] CFP10-38-19a: GGAAGGCATATGGCAGAGATGAAGACCGATGCCGCT

[0025] CFP10-38-19b:TTATTAGGATCCTCCGCCACCGAAGCCCATTTGCGA

[0026] 38kD amplification primers:

[0027] CFP10-38-19e: GCTGACGGATCCGTGAAAATTCGTTTGCATAC

[0028] CFP10-38-19f: GTATTAGAATTCGCTGGAAATCGTCGCGATC

[0029] 19kD amplification primers:

[0030] CFP10-38-19c: AATAGAATTCGGAGGTGGCGGTAGTGTGAAGCGTGGACTGA

[0031] CFP10-38-19d: GTCCGGAAGCTTTTAGGAACAGGTCACCTCGATTTCG

[0032] 50 ml amplification system: ddH 2 O 31.5 ml, 10×buf...

example 2

[0064] Example 2: Preparation and performance test of Mycobacterium tuberculosis antibody IgG diagnostic kit (spot gold immunofiltration method)

[0065] 2.1 Kit composition and preparation

[0066] The kit of the present invention uses the purified Mycobacterium tuberculosis CFP10-38kD-19kD recombinant fusion protein as the TB antigen, and coats it on the nitrocellulose membrane as a detection point. The antigen can capture the IgG tuberculosis antibody in the serum sample, Captured TB antibodies can be combined with staphylococcal protein A (SPA) colloidal gold conjugates to present red spots. There is no red spot in the middle of the reaction well, which means that the tuberculosis antibody in the serum sample is negative, and the quality control point should appear red.

[0067] The main component of the kit is an immunofiltration device, which is mainly composed of three parts: a small plastic box, an absorbent pad and a nitrocellulose membrane. The nitrocellulose membra...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides a Mycobacterium tuberculosis triple recombinant fusion protein CFP10-38kD-19kD and application of the same to clinical diagnosis of pulmonary tuberculosis. According to the invention, three strong antigen epitopes of Mycobacterium tuberculosis are selected; the Mycobacterium tuberculosis triple recombinant fusion protein is constructed by using a PCR method with H37RV as a template; the fusion protein is expressed by using a DNA-hydrogel acellular in-vitro protein expression system; obtained recombinant protein is purified by using metal chelate affinity chromatographic techniques; and then a novel serological detection kit for Mycobacterium tuberculosis is prepared by using dot-immunogold filtration assay with the purified protein as an antigen. Compared with kits of a same kind in the market, the kit prepared in the invention has the advantages of high specificity, high sensitivity and the like and provides a more reliable tool for screening and diagnosis of tuberculosis; and the fusion protein is also applicable to preparation of a protein chip, a vaccine, a monoclonal antibody, a polyclonal antibody, etc.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to the construction and application of a triple recombination fusion protein of Mycobacterium tuberculosis. Background technique [0002] Tuberculosis is a chronic infectious disease caused by Mycobacterium tuberculosis infection. Tuberculosis (TB) is the most common and distributed worldwide. It is the disease with the highest mortality rate caused by a single bacterial infection in the world today. human health. According to statistics, there are about 8 million new cases and 2-3 million deaths worldwide every year. The ultimate burden of global tuberculosis lies in Asia and Africa. my country is one of the countries with the highest burden of tuberculosis in the world, ranking second in the world. Nearly 50% of the people in the country have been infected with tuberculosis, and the annual incidence is about 1 million. The number of people reached 130,000. Among them, only a s...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/62C07K19/00G01N33/68G01N33/569
Inventor 马晓蕾王兴冯书阳
Owner WANLEI LIFE SCISHENYANG CO LTD
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More