Unlock instant, AI-driven research and patent intelligence for your innovation.

Gene chip for specific detection of bacillus thuringiensis

A technology of Bacillus thuringiensis and Bacillus aureus, which is applied in genetic engineering, plant genetic improvement, and methods based on microorganisms. It can solve the problems of classification and identification, small 16SDNA difference, and poor specificity, and achieve reliable results and provide specificity. Effect

Inactive Publication Date: 2017-02-01
SHANXI UNIV
View PDF0 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, the traditional microbial detection method is mainly the culture method. This method has a long detection cycle and cannot classify and identify Bacillus thuringiensis, Bacillus thuringiensis, and Bacillus thuringiensis that are closely related.
In recent years, barcode sequences similar to 16S DNA have also been frequently used in the identification of microorganisms, but the difference between species of 16S DNA is very small, so it is inevitable that the classification and identification based on 16S DNA alone will have the problem of poor specificity

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Gene chip for specific detection of bacillus thuringiensis
  • Gene chip for specific detection of bacillus thuringiensis
  • Gene chip for specific detection of bacillus thuringiensis

Examples

Experimental program
Comparison scheme
Effect test

Embodiment Construction

[0026] Concrete implementation steps of the present invention are as follows:

[0027] Primers and probes were designed by our laboratory and synthesized by Shanghai Sangon Bioengineering Co., Ltd.

[0028] (1) Determination of the target sequence: According to the reported Bacillus thuringiensis 16SDNA sequence and rpoB gene sequence, select the Bacillus thuringiensis rpoB specific gene fragment whose nucleotide sequence is SEQ ID NO: 1, and the nucleotide sequence is SEQ ID NO: 2 The 16S specific gene fragment of Bacillus thuringiensis used as the target sequence for detection.

[0029] (2) Design of primers and probes: After the target sequence is determined, according to the design principles of primers and probes, design primers and probes as follows:

[0030] Bacillus thuringiensis rpoB:

[0031] Primer 1: 5'FAM-GAAGATGCATTACGCAACCTTGAC-3',

[0032] Primer 2: 5'-TGTGAATACCAAGGTATCTTGCTG-3',

[0033] 5'NH 3 — TTTTTTTTTTTT ACTACGTGTACCACACGGTGGTGGCG — 3'.

[0034] Ba...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a gene chip for specific detection of bacillus thuringiensis, and belongs to a soil microorganism gene detection technology. An rpoB unique gene fragment and a 16S unique gene fragment of the bacillus thuringiensis are selected as target sequences for detection according to a reported 16S DNA sequence and rpoB gene sequence of the bacillus thuringiensis, and corresponding multiple PCR amplification primer pairs, probes and detection chips are designed. Accordingly, qualitative and quantitative detection can be conducted on the bacillus thuringiensis in a short time through the gene detection chip, and classification and determination on the bacillus thuringiensis on the species level are achieved; a powerful tool is provided for tracking colonization and reproduction of the bacillus thuringiensis in fertilizer or soil.

Description

[0001] Technical field: [0002] The invention relates to a microorganism DNA detection technology, in particular to a Bacillus thuringiensis DNA detection chip and its preparation, as well as its application in soil microorganism detection. [0003] technical background: [0004] Bacillus thuringiensis, a functional microorganism, is often used to make bio-organic fertilizers and in soil to regulate the microbial flora structure to achieve disease resistance, growth promotion, and quality improvement of crops. However, how to qualitatively and quantitatively track the colonization and reproduction behavior of this bacterium in fertilizers and soils has been perplexing relevant workers. The conventional detection of the number of effective viable bacteria has been unable to meet the needs of scientific research and production. The qualitative and quantitative analysis of common functional bacteria by gene chip technology has strong application value. At present, the traditiona...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/54C12Q1/68C12Q1/04C12N15/11C12R1/07
CPCC12N9/1247C12Q1/6837C12Q1/689C12Y207/07006C12Q2537/143C12Q2545/113C12Q2565/501
Inventor 任振兴王俊红王梦亮刘滇生
Owner SHANXI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More