A gene chip for specific detection of Bacillus megaterium
A technology of Bacillus megaterium and specific genes, applied in the application field of Bacillus megaterium DNA detection chip and its preparation, microbial fertilizer and soil microbial detection, can solve the problems of poor specificity, small 16SDNA difference, classification and identification of Bacillus thuringiensis, etc. problem, achieve reliable results and provide specificity
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment Construction
[0022] Concrete implementation steps of the present invention are as follows:
[0023] Primers and probes were designed by our laboratory and synthesized by Shanghai Sangon Bioengineering Co., Ltd.
[0024] (1) Determination of the target sequence: According to the reported Bacillus megaterium 16SDNA sequence and rpoB gene sequence, select the Bacillus megaterium rpoB specific gene fragment whose nucleotide sequence is SEQ ID NO: 1, and the nucleotide sequence is SEQ ID NO: The 16S specific gene fragment of Bacillus megaterium 2, which is used as the target sequence for detection.
[0025] (2) Design of primers and probes: After the target sequence is determined, according to the design principles of primers and probes, design primers and probes as follows:
[0026] Bacillus megaterium rpoB:
[0027] Primer 1: 5’FAM—GTGTAATTTCACGTATTTTTACCG—3’
[0028] Primer 2: 5'-GCTCATGGTCCTCTTCTGAGTCC-3'
PUM
![No PUM](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/noPUMSmall.5c5f49c7.png)
Abstract
Description
Claims
Application Information
![application no application](https://static-eureka.patsnap.com/ssr/23.2.0/_nuxt/application.06fe782c.png)
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap