Supercharge Your Innovation With Domain-Expert AI Agents!

Pseudocercospora rDNA and application thereof to molecular detection of pseudocercospora

A technology for molecular detection and Cercospora, which is applied in the direction of recombinant DNA technology, DNA/RNA fragments, and microbial-based methods, can solve problems such as cross-host infection, and achieve the effects of increasing scope, convenient use, and wide application range

Active Publication Date: 2017-09-01
SOUTH CHINA AGRI UNIV
View PDF1 Cites 7 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

At present, there are no reports of cross-infection between Pseudomonas mulberry and other bacteria of the same genus, or cross-host infection. It can be basically confirmed that the pathogen of mulberry leaf spot disease is a single fungus, that is, Pseudomococcus mulberry

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Pseudocercospora rDNA and application thereof to molecular detection of pseudocercospora
  • Pseudocercospora rDNA and application thereof to molecular detection of pseudocercospora
  • Pseudocercospora rDNA and application thereof to molecular detection of pseudocercospora

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0043] The rDNA full-length sequence of embodiment 1 Pseudomonas mulberry is obtained

[0044] 1. Using the method of high-throughput sequencing, the full-length rDNA of the pathogenic bacteria of mulberry leaf spot disease—Pseudomonas mulberry was obtained by cloning, as shown in SEQ ID NO.1.

[0045] 2. According to the multiple confirmations of the sequencing results, the full-length rDNA of Pseudomonas mulberry was annotated. As shown in the table, the relationship between each gene segment and the transcriptional spacer (ITS) of the rDNA of Pseudomococcus mulberry was determined. Nucleotide sequence and its position on rDNA.

[0046] Table 1 Annotation of the complete rDNA sequence of Pseudomonas sp.

[0047] Features Start(bp) End(bp) Length(bp) ETS1 1 332 332 18S rRNA 333 2059 1726 ITS1 2060 2225 165 5.8S rRNA 2226 2366 140 ITS2 2367 2516 149 28S rRNA 2517 5815 3298 ETS2 5816 6084 268

Embodiment 2

[0048] Embodiment 2 detection primer design and establishment of PCR amplification method

[0049] 1. Primer design

[0050] On the basis of obtaining the full-length rDNA of Pseudomonas mulberry, several pairs of primers were designed. After a large number of specificity and sensitivity tests, two pairs of representative primer sets were finally selected. The primer sequences are as follows:

[0051] P1-F / P1-R Primer Set

[0052] Upstream primer P1-F: 5'-GTTTCAACGGGTAACGGGGA-3'

[0053] Downstream primer P1-R: 5'-TCCCTACCTGATCCGAGGTC-3'

[0054] W1724f / W2196r Primer Set

[0055] Upstream primer W1724f (SEQ ID NO.4): 5'GCTACACTGACAGAGCCAACG 3'

[0056] Downstream primer W2196r (SEQ ID NO.5): 5'GCTACACTGACAGAGCCAACG 3'.

[0057] 2. Establishment of PCR amplification method

[0058] The total DNA of diseased leaves, branches, and soil was used as a template, and the primers described in Example 1 were used for PCR amplification.

[0059] The PCR reaction system (total vol...

Embodiment 3

[0070] Specific detection of embodiment 3 primer W1724f / W2196r

[0071] 1. Separate the fungus and bacteria from the mycelia of stained leaf spot, and the powdery mildew pathogen (Phyllactinia moricola) and the mulberry sclerotinia pathogen (Ciboriacarunculoides) that are the same as the pathogenic fungus of mulberry as contrast group, use primers W1724f / W2196r, carry out PCR amplification with the method of Example 2, agarose gel electrophoresis detection result after amplification.

[0072] 2. The amplification results of the primers are as attached Figure 4 shown. The results showed that only the DNA of the pathogen of mulberry leaf spot disease (Pseudocercia mulberry) had a band at the target position (473bp). It shows that the primer set can specifically detect Pseudomonas mulberry.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses pseudocercospora rDNA and application thereof to molecular detection of pseudocercospora, and designs a group of pseudocercospora-specific detection primers, including an upstream primer W1724f and a downstream primer W2196r and having the nucleotide sequences shown as SEQ ID NO. 4 and SEQ ID NO. 5 respectively. The detection primers can specifically detect the pseudocercospora, are reliable in detection result, easy to operate and high in specificity and sensitivity, and have an important practical application significance in detection of diseased leaves in the early stage of infection (latent period); and moreover, the detection primers can detect pathogens in soil and on branches so as to estimate the density of the pathogens and take appropriate control measures, so that the detection primers have a guiding significance in control over mulberry leaf mould.

Description

technical field [0001] The invention belongs to the technical field of pathogen molecule detection. More specifically, it relates to the rDNA of Pseudomonas mulberry and its application in the molecular detection of Pseudomococcus mulberry. Background technique [0002] Mulberry leaf stain is the most widespread disease in my country (Zhang rose, 1975). The disease damage is serious, and the disease range has a certain scale. It begins to occur in summer and autumn, and lasts until the leaves fall in winter. It mostly occurs on mature and aging leaves, and occasionally occurs on young leaves. The disease can make the leaf quality of mulberry leaves deteriorate and harden early. , is easy to wither, and cannot be used as edible mulberry, nor is it suitable for raising silkworms (Wang Xiangdong, 2009). The propagation of mulberry leaf spot disease is mainly the mycelium that survives the winter in the diseased leaf tissue. The conidia that survive the winter in the natural e...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Applications(China)
IPC IPC(8): C12N15/11C12Q1/68C12Q1/04C12R1/645
CPCC12N15/11C12Q1/6895C12Q2600/158C12Q2600/178
Inventor 刘吉平刘希
Owner SOUTH CHINA AGRI UNIV
Features
  • R&D
  • Intellectual Property
  • Life Sciences
  • Materials
  • Tech Scout
Why Patsnap Eureka
  • Unparalleled Data Quality
  • Higher Quality Content
  • 60% Fewer Hallucinations
Social media
Patsnap Eureka Blog
Learn More