Looking for breakthrough ideas for innovation challenges? Try Patsnap Eureka!

A molecular marker associated with the "tailless" phenotype of Chinese fat-rump sheep and its application

A technology of sheep and hip type, applied in the field of genetic biology, to achieve the effect of accurate and reliable method and easy operation

Active Publication Date: 2020-01-14
SHIHEZI UNIVERSITY
View PDF2 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

But so far there is no report on the correlation between the SNPs of this gene and the "tailless" phenotype of my country's fat-rump sheep

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A molecular marker associated with the "tailless" phenotype of Chinese fat-rump sheep and its application
  • A molecular marker associated with the "tailless" phenotype of Chinese fat-rump sheep and its application
  • A molecular marker associated with the "tailless" phenotype of Chinese fat-rump sheep and its application

Examples

Experimental program
Comparison scheme
Effect test

specific Embodiment

[0024] chinese sheep T Gene 8:87804590 / 8:87804589 Genotyping.

[0025] 1.1 Extraction of genomic DNA from the blood of local sheep breeds in China

[0026] Blood samples were collected from 225 individual sheep, among which fat hip sheep included 32 Kazakh sheep, 25 Altay sheep, 15 Bashibai sheep, 20 Duolang sheep, and 21 Bayinbulak sheep; long thin tail sheep Sheep include 32 Gansu alpine fine-wool sheep, 12 alpine Merino sheep, and 12 Texel sheep; short thin-tailed sheep include 32 Gansu Ola Tibetan sheep; short fat-tailed sheep include 12 Tan sheep, 12 Hu Goat blood samples, using conventional methods to extract the genomic DNA in the blood.

[0027] 1.2 Amplify the nucleotide fragment containing the target SNP site

[0028] According to the Ensemble database T The sequence of the gene is ENSOARG00000004863.1, and the designed primers are as follows:

[0029] Forward primer: 5'- GCTCTCTGCCACAAGAAGGT -3', SEQ ID No.1;

[0030] Reverse primer: 5'- GCATGCGGATCTAGGTGAGT -...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses an SNP (single-nucleotide polymorphism) marker correlated with detection of tail type characters of sheep and an application of the SNP marker. The SNP marker correlated with detection of the tail type characters of the sheep in China is characterized by being located in two loci, namely, 87804590 / 87804589 of chromosome 8 of the sheep; the two loci of the SNP molecular marker are linked completely; polymorphisms are G-G and C-T; the genotypes comprise G-G / G-G, G-G / C-T and C-T / C-T, the genotype C-T / C-T is only detected in fat-rumped sheep in China, and statistical testsprove that the genotype C-T / C-T is significantly correlated with the tailless phenotype of the sheep. The SNP marker can be applied to early breeding for the tail type characters of local sheep breedsin China, accurate screening can be even performed on sheep in embryonic period or at birth, and a method has the advantages of being accurate, reliable and simple and convenient to operate when usedfor identifying local purebred fat-rumped sheep breeds in China.

Description

technical field [0001] The invention belongs to the field of genetic biology, and relates to molecular markers related to the tail type of sheep, specifically related to the tailless phenotype of Chinese fat buttock type sheep T Gene single nucleotide polymorphism (SNPs) molecular markers and their applications. Background technique [0002] In order to adapt to different environments, sheep have produced breeds with large individual phenotype differences through long-term natural selection, and the difference in tail type is one of the main changes in the evolution process. Modern domesticated sheep evolved from mouflon sheep and ibex, but their tails are all short and thin. After thousands of years of domestication, there are differences in long, short, fat, and thin tails, depending on the length of the tail and the length of the tail The size of fat volume can divide sheep into five types: short fat-tailed sheep, such as small-tailed Han sheep, Hu sheep, etc.; long-fat-...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & Authority Patents(China)
IPC IPC(8): C12Q1/6888C12N15/11
CPCC12Q1/6888C12Q2600/124C12Q2600/156
Inventor 韩吉龙杨博辉杨敏刘建斌郭婷婷岳耀敬牛春娥袁超
Owner SHIHEZI UNIVERSITY
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Patsnap Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Patsnap Eureka Blog
Learn More
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic, Popular Technical Reports.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap|About US| Contact US: help@patsnap.com