34 results about "Complete linkage" patented technology

The invention provides a major SNP (single nucleotide polymorphism) marker influencing the growth traits of pigs. The SNP marker is located at a nucleotide sequence of an HMGA1 gene of a pig chromosome 7, a locus of the SNP marker is the nucleotide mutation of C857-G857 with an SEQ ID NO:1 sequence labeling position of 857, corresponding to a 34983991st nucleotide locus C> on chromosome 7 in a reference sequence in an international pig genome version 10.2, G mutation, or one of seven other loci completely linked with the locus. The invention also provides the application of the SNP marker in the genetic improvement of growth traits of breeding pigs, and provides the application of an SNP molecular marker with a linkage disequilibrium degree (r2) with the SNP marker of greater than 0.8 in the genetic improvement of growth traits of breeding pigs. The growth traits include one or more of the length and height of a living body of a pig, carcass length, carcass weight, daily gain and head weight. According to the invention, the breeding process of breeding pigs can be accelerated, the productivity of breeding pigs can be effectively improved, and remarkable economic benefits can be obtained.

The invention discloses a fire linkage control method and system, wherein the method and the system are applied to urban rail transit. The system uses environment equipment and a monitoring system as a platform to carry out interface relevance with various specialties. According to actual situations, a comprehensive linkage scheme is developed and is operated by a user. The coordination linkage ability of fire disaster relief can be greatly improved. The efficiency of disaster relief is improved. According to the invention, through a redundancy mechanism, the reliability and the stability of a fire disaster relief system are enhanced; when an overall system scheme is designed, an optimized fire alarm confirmation technology is used; the method of combined and mutually redundant FAS and BAS is used for linkage; a unique fire mode instruction transmission and receiving technology, an advanced fire mode instruction decomposition technology and a fire mode linkage control drive technology are used; processing programs carry out communication for various kinds of different professional equipment; and various kinds of data are processed to develop the complete linkage scheme for the user to choose.

The automatically centering central frame consists of support, left large sector gear, left small sector gear, left pressure lever, right pressure lever, roller, upper rotary pin, right small sector gear, right large sector gear, link rod, sliding block, runner block, lower pressure lever slide rail, lower pressure lever and lower rotary pin. It is one opened structure and realizes three bearing point automatic centering by means of the block-link rod mechanism to drive the sector gear mechanism. The complete linkage of the three bearing points can center shaft work piece of different diameter reliably in the same rotary center. The present invention has the features of reliable design, simple structure, wide application range, etc and is especially suitable for automatic control of central frame by means of pneumatic, hydraulic or other modes.

The invention relates to a molecular marker for high lysine maize Opaque7 gene and application thereof. The molecular marker is the codominant molecular marker 6837D which is obtained through PCR amplification of specific primers, and base sequences of the specific primers are as follows: a forward primer has a base sequence of, from 5' terminal to 3' terminal, CCACGGAAGCCCGGGTCAGT, and a reverse primer has a base sequence of, from 5' terminal to 3' terminal, GCGTCCACCTCGATCGGGG. By using the molecular marker in complete linkage with the O7 gene, genotype identification of DNA of any tissue of maize at any stage can be carried out, and the situation of existence and the state of heterozygosis or homozygosis of the O7 gene in each individual plant of a crossbreeding filial generation can be detected; meanwhile, by using the molecular marker, mutants and main domestic breeding parents of 539 species can be differentiated, the O7 gene in a colony of any breeding background can be accurately detected, and the rate of wrong choice is 0. A detection method provided in the invention has high accuracy, is simple to operate and provides a technical approach for DNA molecular marker-assisted selection of the O7 gene.

The invention belongs to the field of rape breeding, particularly relates to rape self-incompatibility complete linkage dominant SCAR labels and the application thereof. Cabbage type rape self-incompatibility S locus dominant SCAR molecular labels are produced artificially, which includes self-incompatibility S locus dominant labels and self-incompatible restorer line S locus dominant labels, wherein the self-incompatibility S locus dominant SCAR labels are named as SRKa, SEKb and SP11a, whose nucleotide sequences are displayed in sequence tables with SEQ ID NO: 1, 2, 6; the self-incompatible restorer line S locus dominant SCAR labels are named as SLGa, SLGb and SLGc, whose nucleotide sequences are displayed in sequence tables with SEQ ID NO: 3, 4, 5. The molecular labels can differentiate homozygous-compatible, hybrid-compatible and homozygous-incompatible genes. The molecular labels are used to verify the cabbage type rape self-incompatibility phenotype. The invention provides practical labels and a usage method for rape molecular breeding.

The invention relates to a molecular mark of a high lysine gene in Zea mays L., and applications of the same. The molecular mark is InDel molecular mark-4.9 and 5.7 which both can be amplified through a PCR reaction and detected through an agarose gel electrophoresis, see base sequences represented by SEQ ID No: 1. By using the molecular mark in complete linkage with 5512G gene, genotype identification can be carried out on DNA of any organization of Zea mays L. in any period, and it is detected whether the 5512G in each individual plant of cross breeding filial generation exists or not in a heterozygosis or homozygous state Simultaneously, by using the molecular mark, the mutant and 22 domestic mainly-breeding parents can be distinguished, and the existence of 5512G can be detected accurately in any breeding background populations. The detection method is high in accuracy and simple in operation, and provides an important technology means for breeding assisted by DNA molecular mark of 5512G.

The invention discloses a method for detecting polymorphism of multiple single nucleotides in a 5' control region of a cattle CIDEC gene. The method comprises the following steps of: with a to-be-detected cattle complete genome DAN containing a CIDEC gene as a template and primer pairs P (P1, P2 and P3) as primers, performing amplification on the cattle CIDEC gene; respectively digesting PCR amplification products with restriction enzymes such as HaeIII, AccI and HaeIII, then carrying out agarose gel electrophoresis on a digested amplified fragment, and identifying polymorphism of single nucleotides at a 974th site, a 956th site and a 501st site of the CIDEC gene of the cattle according to results of agarose gel electrophoresis, wherein polymorphism of the single nucleotide at the 956th site is also the polymorphism of single nucleotides at a 841st site, a 763rd site, 727th site and a 546th site, the polymorphism of the single nucleotide at the 501st site is also the polymorphism of a single nucleotide at a 643rd site owning to complete linkage, and thus polymorphism information of nine sites can be obtained by detecting polymorphism of three sites. The detection method provided by the invention lays a foundation for establishing a relation between the polymorphism of single nucleotides of the CIDEC gene and growth traits, so as to be convenient for marker assisted selection (MAS) on the growth traits for cattle beef in China, and a cattle population with excellent genetic resources can be quickly established.

The invention relates to a molecular marker of a corn Opaque1 gene and application thereof. The molecular marker is a codominant molecular marker MYO-PD obtained by amplifying specific primers through PCR (polymerase chain reaction), wherein the specific primers are base sequences shown as SEQ ID NO.1-SEQ ID NO.2. The molecular marker completely linked with an o1 gene can be used to perform genotype identification on DNA (deoxyribonucleic acid) of a corn at any period and in any tissue, thus detecting the existence of the o1 gene in each individual plant of the hybridization breeding filial generation and the heterozygous or homozygotic state thereof. Meanwhile, the molecular marker can be used to distinguish between mutants and 10 main breeding parents in China and can accurately detect the existence of the o1 gene in any breeding background population, and the mischoosing rate is 0. The detection method is high in accuracy and simple to operate, thus providing an important technical means for o1 gene-based DNA molecular marker aided breeding.

The invention relates to a molecular marking method for two mutation sites in a chicken PTHLH gene 5' regulatory region and application thereof in chicken breeding. Two mutation sites (namely the -1827 (A>G) site and the -165(C>T) site) exist in the chicken PTHLH gene 5' regulatory region, SHEsis online software is used for linkage disequilibrium analysis, and the result shows that the two sites in recessive white plymouth rock are in a complete linkage state. The two sites are related with the first-egg age and egg laying quantity at the 32th week, the first-egg age of AC / GT gene type is remarkably earlier than that of the GT / GT type and the AC / AC type, and meanwhile the egg laying quantity at the 32th week is remarkably larger than that of the other two types. The method is simple, fast and beneficial for breeding chicken variety with the early first-egg age and the large egg laying quantity and provides favorable help for marker-assisted breeding work.

The invention discloses an SNP (single-nucleotide polymorphism) marker correlated with detection of tail type characters of sheep and an application of the SNP marker. The SNP marker correlated with detection of the tail type characters of the sheep in China is characterized by being located in two loci, namely, 87804590 / 87804589 of chromosome 8 of the sheep; the two loci of the SNP molecular marker are linked completely; polymorphisms are G-G and C-T; the genotypes comprise G-G / G-G, G-G / C-T and C-T / C-T, the genotype C-T / C-T is only detected in fat-rumped sheep in China, and statistical testsprove that the genotype C-T / C-T is significantly correlated with the tailless phenotype of the sheep. The SNP marker can be applied to early breeding for the tail type characters of local sheep breedsin China, accurate screening can be even performed on sheep in embryonic period or at birth, and a method has the advantages of being accurate, reliable and simple and convenient to operate when usedfor identifying local purebred fat-rumped sheep breeds in China.

An object of the present invention to provide a hybrid plant having a high fertility and a method for producing such a hybrid plant. The hybrid plant of the present invention is characterized by having two or more copies of a fertility restorer gene at two or more gene loci which do not have a complete linkage relationship. Further, the method of the present invention comprises introducing a fertility restorer gene by genetic engineering and placing two or more copies of a fertility restorer gene at two or more gene loci which do not have a complete linkage relationship.

The invention provides an SNP molecular marker related with pig growth velocity and application thereof. According to the SNP molecular marker disclosed by the invention, a TRPC1 gene is utilized as acandidate gene which can affect the pig growth velocity; a sequencing technique is utilized to screen and identify SNP loci related with the pig growth velocity to obtain 2 SNP loci which can affectthe pig growth velocity and a gene type effect; the 2 SNP loci are respectively arranged (595bp)th and (539bp)th positions of a sequence shown in SEQ ID NO.1; allelotype of the 2 SNP loci is C and T;furthermore, alleles of C and C and T and T of the 2 SNP loci are completely linked on a genome; thus, any SNP locus can be applied to breeding pig breed growth rate characters; furthermore, the SNP loci cannot be limited by ages, genders and breeds of pigs, can be applied to early breeding of the pigs and can quicken a breeding process.

The invention belongs to the field of a domestic animal molecular biotechnology and genetic breeding and discloses molecular cloning of a meat quality trait related gene Prox1 of pigs and application.A full-length cDNA (complementary Deoxyribonucleic Acid) sequence of a pig Prox1 (Prospero-related homeobox protein 1) gene is cloned by utilizing a RACE technology, the full length of the sequence is 3683 bp and sequence characteristics are shown as SEQ ID NO: 4. A dual-luciferase activity analysis technology is used for determining an active region of a pig Prox1 gene promoter region and a positive regulation and control element with influences on the activity of a promoter exists in a -1182 / -1957 bp region; negative regulation and control elements with the influences on the activity of thepromoter exist in a -1182 / -682 bp region, a -682 / -192 bp region and a -192 to +122 bp region. A population sample expression mode shows that the pig Prox1 gene is a gene which is remarkably related to meat colors and can be used as a marker gene for grading the meat colors. Furthermore, 18 hereditary variation sites are identified in a pig Prox1 gene promoter sequence and the invention proves that three hereditary variation sites which are completely interlocked are remarkably related with the pH (Potential of Hydrogen) trait of pork and can be used as an important molecular marker for production trait assisted breeding of pigs.

The invention discloses a single nucleotide polymorphic locus of a cattle I-mfa gene and a detection method thereof. The detection method of the single nucleotide polymorphisms locus of cattle I-mfa gene comprises utilizing cattle whole-genome deoxyribonucleic acid (DNA) to be detected containing the I-mfa gene as a template, utilizing a primer pair P as primers, performing polymerase chain reaction (PCR) amplification on the cattle I-mfa gene and performing polyacrylamide gel electrophoresis on amplified framorphism; according to electrophoresis results, identifying the 12284 locus of the cattle I-mfa gene to be nucleotide polymplate of A or G; and identifying the 12331 locus of the cattle I-mfa gene to be nucleotide polymorphism of T or C. The two locus is completely in linkage. The detection method of the single nucleotide polymorphic locus of the cattle I-mfa gene is a method which screens and detects molecular genetic markers closely related to growth traits of cattle from the DNA level, and provides the molecular basis for cattle crossbreeding utilizing the crossbreed advantages.

The invention discloses a haplotype marker related to the rapid growth of largemouth bass and its application. The haplotype marker consists of the 1313th and 2346th positions of the heat shock protein HSP70 genome sequence SEQ ID NO: 3 of the largemouth bass and its application. The SNP site at the 259th base and the insertion-deletion mutation site at the 259th base and the 2302nd base, these 4 sites are completely linked. Utilize the haplotype mark of the present invention, keep the genotypes of the 1313th, 259th, 2302nd, 2346th in production and be respectively the largemouth bass parent of GA, T-, Y-, AT (Y represents the base fragment CTGTCTTCTGTTCATAAGTGTC), remove Individuals of other genotypes can quickly obtain fast-growing and genetically stable largemouth bass varieties.

The invention relates to a molecular mark of a high lysine gene in Zea mays L., and applications of the same. The molecular mark is InDel molecular mark-4.9 and 5.7 which both can be amplified through a PCR reaction and detected through an agarose gel electrophoresis, see base sequences represented by SEQ ID No: 1. By using the molecular mark in complete linkage with 5512G gene, genotype identification can be carried out on DNA of any organization of Zea mays L. in any period, and it is detected whether the 5512G in each individual plant of cross breeding filial generation exists or not in a heterozygosis or homozygous state Simultaneously, by using the molecular mark, the mutant and 22 domestic mainly-breeding parents can be distinguished, and the existence of 5512G can be detected accurately in any breeding background populations. The detection method is high in accuracy and simple in operation, and provides an important technology means for breeding assisted by DNA molecular mark of 5512G.

The invention discloses an MC4R gene molecular marker related to Sujiang pig production traits. The locus of the molecular marker is selected from at least one of the following loci: (1) locus mutation from C to T of a 160773885th basic group (rs335628164) of a No.1 chromosome of a 11.1 version of a pig reference genome, and (2) locus mutation from A to T of the 160773971st basic group (rs81221063) of the No.1 chromosome of the 11.1 version of the pig reference genome, wherein the two loci are completely interlocked. The correlation analysis determines that the two molecular markers are significantly related to the production traits of the Sujiang pigs, and can be used for molecular marker-assisted selective breeding of the Sujiang pigs.

The invention discloses an SNP marker related to Sujiang pig production traits. The locus of the SNP marker is selected from at least one of the following loci: (1) the locus mutation of the No. 4 chromosome basic group (rs334240650) of the pig reference genome 11.1 version from C to T; (2) the locus mutation of the No. 4 chromosome basic group (rs326013678) of the pig reference genome 11.1 version from A to G; and (3) the locus mutation of the No. 4 chromosome basic group (rs328675134) of the pig reference genome 11.1 version from A to G, wherein the three loci are completely linked. The correlation analysis determines that the three molecular markers are significantly related to the Sujiang pig production traits and can be used in molecular marker-assisted selection breeding of Sujiang pigs.

The invention belongs to the technical field of domestic animal molecular genetic marker screening, and specifically relates to a porcine MMP20 gene segment as a genetic marker of a pig litter size trait and an application. By screening, a genetic marker, as shown by SEQ ID NO:1, related to the pig litter size trait is obtained, the gene segment has a G>C base mutation at a site 257bp, and a C>T base mutation at a site 292bp; and another genetic marker, as shown by SEQ ID NO:2, related to the pig litter size trait is obtained, and the gene segment has a C>G base mutation at a site 257bp and a T>C base mutation at a site 292bp. The above two mutation sites are completely interlocked, so that the pig litter size trait can be significantly affected. The invention further discloses a screening method of the genetic marker and an application of the genetic marker in correlation analysis of the pig litter size trait. The invention provides a novel molecular breeding marker for marker assisted breeding of the pig litter size trait.

The invention discloses a female backcross method for directionally transforming a silkworm plain markings variety into multilunar sex-limiting system. The method comprises the following steps: hybridizing a female common marking sex-limited variety and a male basic common multilunar variety to obtain F1; hybridizing the F1 female and the male recurrent parent (plain marking variety) to obtain F2; backcrossing the F2 multilunar female and the male recurrent parent to obtain BC1; dividing the BC1 into a moth area type 1 and a moth area type 2 according to the phenotype number, and backcrossing the multilunar male of the moth area type 1 and recurrent parent male to obtain BC2; continuously backcrossing the backcrossed offspring multilunar female to the recurrent parent male to BCn; performing female and male selfing on BCn multilunar to obtain S1; carrying out female and male selfing on the S1 multilunar to obtain S2; randomly numbering moth areas with only two phenotypes of common multilunar and Ji multilunar, and performing male and female selfing in the moth areas to obtain S3; and S3, selecting and remaining a breeding area only having common multilunar and Ji multilunar, namely the multilunar sex-limiting system. According to the method, the characteristic of complete linkage of female silkworms and the principle of interaction of multilunar and common markings are fully utilized, the silkworm common marking variety is directionally transformed into the multilunar sex-limiting system, and the method is high in feasibility, good in character retention degree and high in practicability.

The invention discloses a map linkage method and relates to the electronic field. The method includes the following steps: S1, constructing a map of the control layer, and the full coverage of the map of the control layer needs to be linked with a map of the display layer; S2, selecting any map from the maps of the display layer that need to be linked as the main map of the display layer, The map of the control layer is bound to the map of the main display layer; S3, the map of the control layer obtains the user's operation instruction through the map of the main display layer, and then sends the order in real time to the map of the sub-display layer except the map of the main display layer Directive operation control map instruction; S4, the sub-display layer map adjusts the map according to the one-way operation control map instruction, and completes the linkage of all maps that need to be displayed. The present invention ensures that all the maps on the presentation layer can simultaneously receive the command for changing the display range of the map, thereby ensuring the absolute synchronization effect of all the maps during linkage.

The invention belongs to the technical field of pepper variety breeding, and relates to an SNP (Single Nucleotide Polymorphism) molecular marker KQ8-3918 closely linked with a gene for controlling the Vc content of pepper fruits, a special primer for amplifying the molecular marker, a kit and application of the molecular marker KQ8-3918 and the special primer and the kit. A pepper high-density complete linkage genetic map is constructed for an RILs group containing 252 strains through an SLAF-seq technology, phenotypic data of the Vc content of fruits of all the strains of RILs in three seasons are combined, major QTL for controlling the Vc content of the fruits is positioned to a chromosome 1, a closely-linked SNP molecular marker KQ8-3918 is obtained, and the marker is located at the chromosome 1 32485915bp. A specific amplification primer developed by using the molecular marker can efficiently and accurately identify whether a pepper material or variety belongs to a material or variety with high fruit Vc content, and the breeding efficiency can be remarkably improved.

The invention discloses an SNP (single-nucleotide polymorphism) marker correlated with detection of tail type characters of sheep and an application of the SNP marker. The SNP marker correlated with detection of the tail type characters of the sheep in China is characterized by being located in two loci, namely, 87804590 / 87804589 of chromosome 8 of the sheep; the two loci of the SNP molecular marker are linked completely; polymorphisms are G-G and C-T; the genotypes comprise G-G / G-G, G-G / C-T and C-T / C-T, the genotype C-T / C-T is only detected in fat-rumped sheep in China, and statistical testsprove that the genotype C-T / C-T is significantly correlated with the tailless phenotype of the sheep. The SNP marker can be applied to early breeding for the tail type characters of local sheep breedsin China, accurate screening can be even performed on sheep in embryonic period or at birth, and a method has the advantages of being accurate, reliable and simple and convenient to operate when usedfor identifying local purebred fat-rumped sheep breeds in China.

The invention discloses a fire linkage control method and system, wherein the method and the system are applied to urban rail transit. The system uses environment equipment and a monitoring system as a platform to carry out interface relevance with various specialties. According to actual situations, a comprehensive linkage scheme is developed and is operated by a user. The coordination linkage ability of fire disaster relief can be greatly improved. The efficiency of disaster relief is improved. According to the invention, through a redundancy mechanism, the reliability and the stability of a fire disaster relief system are enhanced; when an overall system scheme is designed, an optimized fire alarm confirmation technology is used; the method of combined and mutually redundant FAS and BAS is used for linkage; a unique fire mode instruction transmission and receiving technology, an advanced fire mode instruction decomposition technology and a fire mode linkage control drive technology are used; processing programs carry out communication for various kinds of different professional equipment; and various kinds of data are processed to develop the complete linkage scheme for the user to choose.

The invention belongs to the field of rape breeding, particularly relates to rape self-incompatibility complete linkage dominant SCAR labels and the application thereof. Cabbage type rape self-incompatibility S locus dominant SCAR molecular labels are produced artificially, which includes self-incompatibility S locus dominant labels and self-incompatible restorer line S locus dominant labels, wherein the self-incompatibility S locus dominant SCAR labels are named as SRKa, SEKb and SP11a, whose nucleotide sequences are displayed in sequence tables with SEQ ID NO: 1, 2, 6; the self-incompatiblerestorer line S locus dominant SCAR labels are named as SLGa, SLGb and SLGc, whose nucleotide sequences are displayed in sequence tables with SEQ ID NO: 3, 4, 5. The molecular labels can differentiate homozygous-compatible, hybrid-compatible and homozygous-incompatible genes. The molecular labels are used to verify the cabbage type rape self-incompatibility phenotype. The invention provides practical labels and a usage method for rape molecular breeding.

The invention belongs to the technical field of molecular genetics, and in particular relates to a group of SNP molecular markers used for screening and / or detecting the abnormality rate of sperm of breeding bulls. The PRKCB gene has 12 fully linked SNP sites, and 2 haplotypes were obtained by haplotype analysis, namely H1 (TCTGTTTCTAAC) and H2 (CTCACCCTCTCA), and there are a total of 3 haplotype combinations H1H1, H1H2, and H2H2. The correlation analysis with semen quality of bulls showed that the deformity rate of bulls with H1H2 haplotype combination was significantly lower than that of bulls with H1H1 and H2H2 haplotype combination after thawing frozen semen (P<0.05).

The invention discloses a method for detecting polymorphism of multiple single nucleotides in a 5' control region of a cattle CIDEC gene. The method comprises the following steps of: with a to-be-detected cattle complete genome DAN containing a CIDEC gene as a template and primer pairs P (P1, P2 and P3) as primers, performing amplification on the cattle CIDEC gene; respectively digesting PCR amplification products with restriction enzymes such as HaeIII, AccI and HaeIII, then carrying out agarose gel electrophoresis on a digested amplified fragment, and identifying polymorphism of single nucleotides at a 974th site, a 956th site and a 501st site of the CIDEC gene of the cattle according to results of agarose gel electrophoresis, wherein polymorphism of the single nucleotide at the 956th site is also the polymorphism of single nucleotides at a 841st site, a 763rd site, 727th site and a 546th site, the polymorphism of the single nucleotide at the 501st site is also the polymorphism of a single nucleotide at a 643rd site owning to complete linkage, and thus polymorphism information of nine sites can be obtained by detecting polymorphism of three sites. The detection method provided by the invention lays a foundation for establishing a relation between the polymorphism of single nucleotides of the CIDEC gene and growth traits, so as to be convenient for marker assisted selection (MAS) on the growth traits for cattle beef in China, and a cattle population with excellent genetic resources can be quickly established.