Molecular cloning of meat quality trait related gene Prox1 (Prospero-related homeobox protein 1) of pigs and application

A gene and production trait technology, applied in the field of livestock molecular biology technology and genetic breeding, can solve the problems of high cost and slow genetic progress.

Active Publication Date: 2019-04-05
NANJING AGRICULTURAL UNIVERSITY
View PDF1 Cites 2 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0003] In the past few decades, the conventional breeding technology system has made great progress in the genetic improvement of medium and high heritability traits, such as growth rate, feed conversion efficiency, carcass lean meat percentage, etc. Traits, when using conventional breeding technology systems for genetic selection, not only the cost is high, but the genetic progress achieved is also very slow

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular cloning of meat quality trait related gene Prox1 (Prospero-related homeobox protein 1) of pigs and application
  • Molecular cloning of meat quality trait related gene Prox1 (Prospero-related homeobox protein 1) of pigs and application
  • Molecular cloning of meat quality trait related gene Prox1 (Prospero-related homeobox protein 1) of pigs and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0031] Embodiment 1: Cloning the full-length cDNA nucleotide sequence of pig Prox1 gene

[0032] 1.1. Primer design

[0033] Using the porcine Prox1 gene mRNA sequence (NM_001128490.1) predicted in the NCBI database (https: / / www.ncbi.nlm.nih.gov / ) as the seed sequence SEQ ID NO: 1 as a template to design amplification primers, in which 5 '-RACE-specific primers (GSPs) should meet the length of 23–28nt, GC content between 50–70%, and Universal PrimerMix ( The general primers designed by the RACE 5' / 3'Kit kit include Long Primer and Short Primer) whose 3' ends are not complementary, etc., and two primers are designed to meet the above conditions, namely GSP1 and NGSP1. GATTACGCCAAGCTT was added to the 5' end to facilitate vector ligation and sequencing in subsequent experiments. The design of the 3'-RACE-specific primers of Prox1 gene was similar to that of the 5'-RACE-specific primers. The designed primers were named GSP2 and NGSP2 respectively, and GATTACGCCAAGCTT was added ...

Embodiment 2

[0044] Example 2: Cloning and activity identification of the proximal promoter region of pig Prox1 gene

[0045] 2.1 Cloning of the proximal promoter region of the porcine Prox1 gene and construction of the deletion expression vector

[0046] (1) Retrieve the genome sequence containing the porcine Prox1 gene (NCBI Reference Sequence: NC_010451.3) from the NCBI database (https: / / www.ncbi.nlm.nih.gov / ) Sscrofa10.2 version, combined with 5'RACE Prox1 5'UTR sequence, the 1957bp DNA fragment before the transcription start site T is used as the potential promoter region of Prox1 gene.

[0047] (2) Using the sequence downloaded from the database as a template, 5 pairs of promoter primers with different lengths were designed, and the 5 5' deletion fragments shared the same downstream primer, which was named PR. The upstream primers were named as P1F, P2F, P3F, P4F and P5F respectively. The 5 pairs of primers designed are shown in Table 2. The PCR reaction system: about 200 ng of DNA ...

preparation example 3

[0074] Preparation Example 3: Analysis of Porcine Prox1 Gene Expression Pattern

[0075] To determine the potential relationship between Prox1 expression patterns and skeletal muscle fiber types, we randomly selected three Duroc×Meishan binary hybrid pigs, and collected heart, liver, spleen, kidney, fat, and bones of two different muscle fiber types Muscle tissue biceps femoris (white muscle) and soleus muscle (red muscle). Utilize TRIzol reagent to carry out the extraction of total RNA (Invitrogen company product), utilize Prime Script TM The reagent was used to synthesize the first strand of cDNA (product of TaKaRa Company), and then the expression level of Prxo1 gene was detected by Real-time PCR. Based on the cloned full-length cDNA nucleotide sequence of the porcine Prox1 gene SEQ ID NO: 4 as a reference, Real-time PCR primers were designed, and the quantitative upstream and downstream primer sequences were Prox1-F: CCGTTTCAGAGTCCGTTAGGT; Prox1-R: TGGTGGGATGACATCTTGGTC, ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the field of a domestic animal molecular biotechnology and genetic breeding and discloses molecular cloning of a meat quality trait related gene Prox1 of pigs and application.A full-length cDNA (complementary Deoxyribonucleic Acid) sequence of a pig Prox1 (Prospero-related homeobox protein 1) gene is cloned by utilizing a RACE technology, the full length of the sequence is 3683 bp and sequence characteristics are shown as SEQ ID NO: 4. A dual-luciferase activity analysis technology is used for determining an active region of a pig Prox1 gene promoter region and a positive regulation and control element with influences on the activity of a promoter exists in a -1182 / -1957 bp region; negative regulation and control elements with the influences on the activity of thepromoter exist in a -1182 / -682 bp region, a -682 / -192 bp region and a -192 to +122 bp region. A population sample expression mode shows that the pig Prox1 gene is a gene which is remarkably related to meat colors and can be used as a marker gene for grading the meat colors. Furthermore, 18 hereditary variation sites are identified in a pig Prox1 gene promoter sequence and the invention proves that three hereditary variation sites which are completely interlocked are remarkably related with the pH (Potential of Hydrogen) trait of pork and can be used as an important molecular marker for production trait assisted breeding of pigs.

Description

technical field [0001] The invention belongs to the field of livestock molecular biology technology and genetic breeding, and relates to a clone comprising the full-length cDNA sequence of the pig Prox1 gene shown in SEQ ID NO: 4, and a proximal promoter of the pig Prox1 gene shown in SEQ ID NO: 5 Subsequence cloning and promoter activity analysis; in addition, the present invention also relates to the analysis of the expression pattern of the pig Prox1 gene and the development and application of molecular markers that affect pork quality traits. Background technique [0002] Pork is the main source of animal protein in people's daily life. With the improvement of consumption level, people's requirements for pork quality also increase accordingly. Therefore, how to better improve meat quality has attracted more and more attention. Meat quality (referred to as meat quality) can be evaluated by many technical indicators, such as meat color, pH value, water retention, intramusc...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/12C12N15/113C12N15/11C12Q1/6888
CPCC12Q1/6888C07K14/47C12Q2600/124C12Q2600/156
Inventor吴望军董超刘红林张增凯陈禹均张锡英
OwnerNANJING AGRICULTURAL UNIVERSITY