Patents
Literature
Patsnap Eureka AI that helps you search prior art, draft patents, and assess FTO risks, powered by patent and scientific literature data.

38 results about "Genetic selection" patented technology

Tuna pond culture strategy optimization method and system based on meteorological influence analysis

The invention discloses a tuna pond culture strategy optimization method and system based on meteorological influence analysis, and the method comprises the steps: collecting regional meteorological data and pond culture monitoring data, and constructing a multi-modal pond ecological feature vector; establishing a weather-water body dynamic coupling model by using a space-time diagram neural network, and generating water body situation response prediction information; a breeding regulation and control strategy is made based on the prediction information, and strategy self-adaptive optimization is achieved through real-time monitoring data; evaluating the anti-disaster capability of the tuna after the meteorological influence is finished, screening high-quality germplasm resources by combining genetic analysis, and generating an anti-disaster breeding scheme. According to the method, full-chain optimization from meteorological early warning to culture regulation and control to genetic breeding is achieved, and the climate toughness and economic benefits of tuna pond culture are comprehensively improved.
Owner:SOUTH CHINA SEA FISHERIES RES INST CHINESE ACAD OF FISHERY SCI +3

Molecular marker related to siniperca chuatsi excellent feed utilization character and application

The invention discloses a molecular marker related to excellent feed utilization characters of siniperca chuatsi and application. The molecular marker is located on a No.15 chromosome of siniperca chuatsi, and the molecular marker contains one SNP (Single Nucleotide Polymorphism) site kmt2e-1; the SNP site kmt2e-1 is located at the 10368245th basic group of the No.15 chromosome of siniperca chuatsi, and the polymorphic site is C / T. According to the invention, SNP typing based on feed utilization characters is realized in siniperca chuatsi for the first time, and the accuracy and efficiency of genetic breeding are improved.
Owner:HUAZHONG AGRI UNIV

Pig chromosome 3 TMC7 gene as meat-producing character molecular breeding marker and application of pig chromosome 3 TMC7 gene

PendingCN121109610AMicrobiological testing/measurementFood processingFrench Large White pigLean meat
The invention belongs to the technical field of molecular biology, particularly relates to a pig chromosome 3 TMC7 gene as a meat-producing character molecular breeding marker and application, and aims to provide a new marker and technical support for meat-producing character molecular breeding of pigs. The molecular marker is located at the 26346502 base in a pig chromosome 3 TMC7 gene, and allele G / T polymorphism exists at the site. A correlation analysis result shows that in American and French large white pig populations, the eye muscle area of a GG genotype individual is remarkably higher than that of other genotype individuals (plt; 0.05), and it is indicated that the genotype is a favorable genotype of the eye muscle area character. The SNP marker provided by the invention provides a new molecular tool for genetic breeding of pig eye muscle area characters, and can be used for auxiliary screening of breeding pigs with excellent meat production performance, so that the breeding process of pig breeds with high lean meat percentage is accelerated.
Owner:HUAZHONG AGRI UNIV

Method for stabilizing metaplasia of subtropical silkworm mid-line variety

PendingCN121986760AAnimal husbandryAnimal scienceSericulture
The invention relates to the technical field of genetic breeding, and discloses a method for stabilizing the chemical property of a subtropical silkworm mid-line variety, which comprises the following steps: screening an egg circle with the optimal chemical property from a production group to establish an initial group; second-generation frame seed production is obtained through incubation and single moth breeding in combination with comprehensive screening of pupa unified life rate, cocoon quality and offspring hatching rate; single moth breeding screening is repeated twice, and third-generation and fourth-generation frame seed production is obtained; adopting a 4 / 4 moth area mixed breeding method to obtain five-generation frame seed production; then five-generation frame seed production is used as a new starting point, the breeding and screening processes are repeatedly executed, each time 4 / 4 moth area mixed breeding is executed as a breeding cycle, and at least two breeding cycles are continuously executed until a new silkworm strain with the sum of the seed generation rate and the re-egg-out rate stably lower than 0.5% is obtained. The method is used for cultivating new silkworm strains which are stable in chemical property and maintain excellent economic characters and robustness, and provides support for stable development of the silkworm industry.
Owner:SERICULTURE TECH PROMOTION STATION OF GUANGXI ZHUANG AUTONOMOUS REGION

MiRNA related to egg yield of parrot and application of miRNA

The invention relates to the field of molecular markers, and particularly provides miRNA (micro Ribonucleic Acid) related to the egg yield of Melopsis undulata and application of the miRNA. According to the present invention, the high-throughput sequencing technology and the miRNA-mRNA association analysis are adopted to screen the related miRNA for regulating and controlling the parrot egg laying traits, the miRNA is mun-miR-367-3p, the nucleotide sequence of the miRNA is AAUUGCACUUAGCAAUGGUG, and the miRNA can be adopted as the molecular marker related to the parrot egg laying amount, and has important practical application value in the genetic breeding of the parrot egg laying amount traits.
Owner:GUANGDONG ECO ENGINEERING POLYTECHNIC

Molecular marker pmel17 gene for blackening of breast muscle of mushan chicken and genetic marker method

The present application belongs to the field of molecular biology technology and breeding of Muxuan black-bone chickens, and particularly relates to a PMEL17 gene for breast muscle blackness of Muxuan black-bone chickens and a genetic marker method thereof. The nucleotide sequence of the gene is shown as SEQ ID NO. 1. The marker method is to design a primer pair, take the genomic DNA of Muxuan black-bone chickens as a template, perform PCR amplification, obtain a sequence shown as SEQ ID NO. 4, identify whether the sequence has a mutation, and analyze the correlation between the mutation and the breast muscle blackness of Muxuan black-bone chickens. The screened gene is a gene related to the breast muscle blackness of Muxuan black-bone chickens, and further screening of a SNP related to the trait at a 553th site of the PMEL17 gene sequence can be used as a genetic marker for auxiliary selection of Muxuan black-bone chickens. Through the genetic marker, Muxuan black-bone chickens with more melanin deposition and darker color can be selected and bred, which has important significance and application value for the genetic breeding of Muxuan black-bone chickens.
Owner:FOSHAN UNIVERSITY

SNP markers for predicting high water temperature tolerance of olive flounder and uses thereof

To provide an SNP marker composition for predicting high water temperature tolerance of olive flounder, and a method for predicting high water temperature tolerance of olive flounder using the same.SOLUTION: An SNP marker composition for predicting high water temperature tolerance of olive flounder according to the present disclosure includes one or more selected from the group consisting of polynucleotides composed of 10 to 100 consecutive nucleotides, or polynucleotides complementary thereto, each containing a predetermined SNP at a predetermined position in a polynucleotide composed of a nucleotide sequence of SEQ ID NOs: 1 to 30. The SNP marker composition of the present disclosure can be utilized for genetic selection of olive flounder having tolerance to high water temperature, and can promote development of high water temperature-tolerant varieties and sustainable production.SELECTED DRAWING: Figure 4a
Owner:IND ACADEMIC COOPERATION FOUND JEJU NAT UNIVERSTIY

InDel marker linked with salt tolerance of millet in germination period and application of InDel marker

The invention belongs to the technical field of molecular markers, and particularly relates to an InDel marker linked with salt tolerance of millet in the germination period and application of the InDel marker, the nucleotide sequence of the InDel marker is shown as SEQ ID NO.1, and G or GGCAGCCACCACA is located at the 301st basic group. The invention discloses an InDel molecular marker linked with the salt tolerance of millet in a germination period. The salt tolerance of the millet in the germination period can be subjected to good typing by utilizing the InDel molecular marker. According to the polymorphism difference, the molecular marker can be used for molecular marker-assisted breeding of the salt tolerance of the millet in the germination period, molecular-assisted technical support is provided for early identification and screening breeding of the salt tolerance of the millet in the germination period, and the molecular marker has important theoretical and practical guiding significance for accelerating genetic breeding of salt-tolerant millet varieties.
Owner:MILLET RES INST OF SHANXI AGRI UNIV (MILLET RES INST OF SHANXI ACAD OF AGRI SCI)

SiRNA for targeting and inhibiting expression of chicken plcd4 gene and application thereof

The application belongs to the technical field of poultry breeding, and discloses siRNA for targeted inhibition of chicken PLCD4 gene expression and application thereof; the siRNA comprises PLCD4-853, PLCD4-528 and PLCD4-1870; the siRNA for targeted inhibition of chicken PLCD4 gene expression can effectively reduce the expression of the chicken PLCD4 gene after being introduced into chicken primary subcutaneous adipocytes, and the inhibition efficiency is more than 50%, and the knockdown efficiency is very high; the siRNA can be used for identifying gene functions by specifically knocking down the expression of the chicken PLCD4 gene in vitro, and can be applied to genetic selection of high-quality broiler subcutaneous fat deposition as a molecular marker, and has great economic value and scientific research value.
Owner:JIANGSU INST OF POULTRY SCI

SNP markers for predicting high water temperature tolerance of olive flounder and uses thereof

To provide an SNP marker composition for predicting high water temperature tolerance of olive flounder, and a method for predicting high water temperature tolerance of olive flounder using the same.SOLUTION: An SNP marker composition for predicting high water temperature tolerance of olive flounder according to the present disclosure includes one or more selected from the group consisting of polynucleotides composed of 10 to 100 consecutive nucleotides, or polynucleotides complementary thereto, each containing a predetermined SNP at a predetermined position in a polynucleotide composed of a nucleotide sequence of SEQ ID NOs: 1 to 30. The SNP marker composition of the present disclosure can be utilized for genetic selection of olive flounder having tolerance to high water temperature, and can promote development of high water temperature-tolerant varieties and sustainable production.SELECTED DRAWING: Figure 4a
Owner:IND ACADEMIC COOPERATION FOUND JEJU NAT UNIVERSTIY

DGKA gene molecular marker related to egg-laying cluster number and egg-laying persistence of laying hens, application and method

The invention relates to the technical field of poultry genetic breeding and biology, in particular to a DGKA gene molecular marker for laying hen egg-laying persistent breeding, application and a method, and belongs to the technical field of molecular marker-assisted breeding. The molecular marker is located on a No.34 chromosome of a chicken reference genome bGalGal1. Mat.broil.GRCg7b, the 1334260th site has G / A polymorphism and is located in a 5 '-UTR region of a DGKA gene, and the SNP can be used as the molecular marker and is used for early genetic breeding of high-egg-yield persistent laying hens. The molecular marker is applied to early screening and genetic breeding of high-egg-yield persistent laying hens, breeding accuracy and breeding efficiency can be remarkably improved, phenotype determination cost is reduced, and the molecular marker has important economic value and popularization and application prospects for promoting efficient and precise development of the laying hen industry.
Owner:SHANGHAI ACAD OF AGRI SCI

SNP markers for predicting high water temperature tolerance of olive flounder and uses thereof

To provide an SNP marker composition for predicting high water temperature tolerance of olive flounder, and a method for predicting high water temperature tolerance of olive flounder using the same.SOLUTION: An SNP marker composition for predicting high water temperature tolerance of olive flounder according to the present disclosure includes one or more selected from the group consisting of polynucleotides composed of 10 to 100 consecutive nucleotides, or polynucleotides complementary thereto, each containing a predetermined SNP at a predetermined position in a polynucleotide composed of a nucleotide sequence of SEQ ID NOs: 1 to 30. The SNP marker composition of the present disclosure can be utilized for genetic selection of olive flounder having tolerance to high water temperature, and can promote development of high water temperature-tolerant varieties and sustainable production.SELECTED DRAWING: Figure 4a
Owner:IND ACADEMIC COOPERATION FOUND JEJU NAT UNIVERSTIY

Improved color-coded male sterile system for targeted selection of cereal plants

The present invention relates to a cereal plant comprising an engineered alien addition chromosome carrying a male fertility restorer gene and a co-segregating set of genes contributing to a color characterized by a low misdivision rate. Further the present invention relates to a cell, a seed, or a progeny or part thereof of the cereal plant comprising said male fertility restorer gene and said set of genes. The invention also relates to a method for selecting and / or sorting at least one male-sterile female seed of a cereal plant. The present invention also relates to a method of generating a color-coded male sterile system for phenotypic and / or genetic selection of cereal plants. Further the present invention relates to an engineered alien addition chromosome carrying the above mentioned structural features.
Owner:KWS SAAT SE & CO KGAA +1

An intelligent control method and system based on a high-voltage substation and an electronic device

The application discloses an intelligent control method and system based on a high-voltage transformer substation and electronic equipment, the method comprising the following steps: reading corresponding recording wave data from a database in response to a pre-warning message sent by a region to be monitored, so as to determine a recording wave feature vector set according to the recording wave data; selecting Q initial populations from M groups of original data at any time based on each feature in the recording wave feature vector set; initializing the number of iterations, calculating the fitness value of each individual in each initial population based on a target function; outputting the individual with the highest fitness value as the optimal individual of the current population through genetic selection, so as to determine one or more elements associated with the optimal individual; marking a fault or a risk according to the number of elements; and controlling the disconnection of a fault element or a line to troubleshoot the fault element or the fault line. The application can retain elements with higher risk probabilities, and eliminate calculation errors and complexity caused by recording wave data redundancy.
Owner:INNER MONGOLIA SHUANGXIN COAL MINE CO LTD

SNP (Single Nucleotide Polymorphism) and KASP (Kinase Associated Specific Protein) markers closely linked with corn tassel branching

The invention discloses SNP and KASP markers closely linked with the number of corn tassel branches and application of the SNP and KASP markers, and belongs to the technical field of molecular marker-assisted breeding. The invention provides an SNP (Single Nucleotide Polymorphism) marker and a KASP (Kinase Associated Specific Protein) marker which are closely linked with the number of corn tassel The SNP is located at 24904636bp of a chromosome 3 of a V4 version of the B73 genome; the forward primer of the KASP marker is 1TBN23-KASP-106F1 and the forward primer of the KASP marker is 1TBN23-KASP-106F2, and the reverse primer of the KASP marker is 1TBN23-KASP-106R; the provided SNP and KASP markers can be used for good typing of the corn tassel branch number, can be used for identification of the character of the corn tassel branch number and molecular marker-assisted breeding, and have important theoretical and practical guiding significance for accelerating the genetic breeding and improvement process of corn varieties.
Owner:AGRICULTURAL GENOMICS INSTITUTE AT SHENZHEN CHINESE ACADEMY OF AGRICULTURAL SCIENCES (SHENZHEN BRANCH GUANGDONG LABORATORY FOR LINGNAN MODERN AGRICULTURE)

SiRNA for targeting and inhibiting expression of chicken ULK2 and application thereof

ActiveCN119752888BBiotechnologyMyogenic cell
The application belongs to the technical field of poultry breeding, and discloses siRNA for targeted inhibition of chicken ULK2 expression and application thereof; the siRNA comprises ULK2-1170; the siRNA for targeted inhibition of chicken ULK2 gene expression can effectively reduce the expression of the chicken ULK2 gene after being transferred into chicken primary myoblast cells, the inhibition efficiency is more than 50%, and the knockdown efficiency is very high; the siRNA can be used for identifying gene functions by specifically knocking down the expression of the chicken ULK2 gene in vitro, and can be applied to genetic selection of high-quality broiler leg muscle development as a molecular marker, and has great economic value and scientific research value.
Owner:JIANGSU INST OF POULTRY SCI

SiRNA for targeted inhibition of expression of FTO gene in intramuscular fat cells and application

The invention belongs to the technical field of poultry breeding, and discloses siRNA for targeted inhibition of chicken FTO expression and application thereof. The siRNA comprises FTO-858 (Fluorine Doped The siRNA can inhibit the expression of the chicken FTO gene in a targeted manner, after the siRNA is transferred into chicken primary intramuscular fat cells, the expression of the chicken FTO gene can be effectively reduced, the inhibition efficiency reaches 50% or above, and the knock-down efficiency is very high; the siRNA identifies the gene function by specifically knocking down the expression of the chicken FTO gene in vitro, can be used as a molecular marker to be applied to genetic breeding of intramuscular fat deposition of high-quality broilers, and has great economic value and scientific research value.
Owner:YANGTZE UNIVERSITY

SiRNA for targeting and inhibiting expression of chicken PLCB2 gene and application thereof

The application belongs to the technical field of poultry breeding, and discloses siRNA for targeted inhibition of chicken PLCB2 gene expression and application thereof; the siRNA comprises PLCB2-409, PLCB2-2566 and PLCB2-3239; the siRNA for targeted inhibition of chicken PLCB2 gene expression can effectively reduce the expression of the chicken PLCB2 gene after being converted into chicken primary subcutaneous adipose cells, and the inhibition efficiency is more than 50%; the siRNA can be used for identifying gene functions by specifically knocking down the expression of the chicken PLCB2 gene in vitro, and can be applied to genetic selection of high-quality broiler subcutaneous fat deposition as a molecular marker, and has great economic value and scientific research value.
Owner:JIANGSU INST OF POULTRY SCI

SNP markers for predicting high water temperature tolerance of olive flounder and uses thereof

To provide an SNP marker composition for predicting high water temperature tolerance of olive flounder, and a method for predicting high water temperature tolerance of olive flounder using the same.SOLUTION: An SNP marker composition for predicting high water temperature tolerance of olive flounder according to the present disclosure includes one or more selected from the group consisting of polynucleotides composed of 10 to 100 consecutive nucleotides, or polynucleotides complementary thereto, each containing a predetermined SNP at a predetermined position in a polynucleotide composed of a nucleotide sequence of SEQ ID NOs: 1 to 30. The SNP marker composition of the present disclosure can be utilized for genetic selection of olive flounder having tolerance to high water temperature, and can promote development of high water temperature-tolerant varieties and sustainable production.SELECTED DRAWING: Figure 4a
Owner:IND ACADEMIC COOPERATION FOUND JEJU NAT UNIVERSTIY

SNP, KASP marker closely linked to the number of tassel branches of maize and its application

The application discloses a SNP (Single Nucleotide Polymorphism) closely linked with the number of tassel branches of corn, a KASP (Kompetitive Allele Specific PCR) marker and application thereof, and belongs to the technical field of molecular marker assisted breeding.The application provides a SNP and a KASP marker closely linked with the number of tassel branches of corn; the SNP is located at 24904636bp of a No.3 chromosome of a V4 version of a B73 genome; the forward primer of the KASP marker is 1TBN23-KASP-106F1 and 1TBN23-KASP-106F2, and the reverse primer is 1TBN23-KASP-106R; the provided SNP and KASP marker can be used for good typing of the number of tassel branches of corn, and can be used for identification of the number of tassel branches of corn and molecular marker assisted breeding, and has important theoretical and practical guiding significance for accelerating the genetic breeding and improvement process of corn varieties.
Owner:AGRICULTURAL GENOMICS INSTITUTE AT SHENZHEN CHINESE ACADEMY OF AGRICULTURAL SCIENCES (SHENZHEN BRANCH GUANGDONG LABORATORY FOR LINGNAN MODERN AGRICULTURE)

SNP (Single Nucleotide Polymorphism) marker combination applicable to anti-flow breeding of pseudosciaena crocea

The invention belongs to the technical field of molecular assisted selective breeding, and provides an SNP marker combination applicable to anti-flow breeding of pseudosciaena crocea, the SNP marker comprises 1000 SNP molecular markers, and the information of the 1000 SNP molecular markers is shown in a table 1. The progeny pseudosciaena crocea bred by using the SNP marker combination is excellent in flow resistance, and has extremely high genetic selection potential and breeding application value. The SNP marker combination as an efficient molecular tool for anti-flow breeding of the large yellow croaker can be directly applied to the breeding industry, the breeding period is greatly shortened through marker-assisted selection, anti-flow progeny is rapidly cultivated, and the SNP marker combination is particularly suitable for deep and far sea breeding scenes with complex water flow environments, so that a breakthrough solution is provided for anti-flow breeding of the large yellow croaker; the method is of great significance to promotion of mariculture variety improvement and deep and far-reaching mariculture industry development, and has wide application prospects and remarkable commercial value.
Owner:XIAMEN UNIV

An Indel marker EH-03-Indel-108 closely linked to ear height in maize and its application.

This invention relates to the field of plant molecular breeding technology, specifically to an Indel marker EH-03-Indel-108 closely linked to ear height in maize and its application. This marker is located in a specific region of maize chromosome 3 and is a 4bp insertion / deletion polymorphic marker. Using specific primer pairs, PCR amplification, and agarose gel electrophoresis, ear haplotypes can be determined based on the 216bp band. It has wide applications in marker-assisted breeding of maize, enabling the screening of low ear height, lodging-resistant varieties. Compared with existing technologies, this invention can accurately identify the ear height trait in maize, improve the efficiency of lodging-resistant variety breeding, is simple to operate, low in cost, promotes maize genetic improvement, enhances the selectivity of breeding materials, and has significant theoretical and practical implications for the study of the molecular mechanisms of maize ear height and the process of genetic selection and improvement.
Owner:AGRICULTURAL GENOMICS INSTITUTE AT SHENZHEN CHINESE ACADEMY OF AGRICULTURAL SCIENCES (SHENZHEN BRANCH GUANGDONG LABORATORY FOR LINGNAN MODERN AGRICULTURE)

Method for detecting CNV marker of HMGA2 gene of Suhu mutton sheep and application of method

The invention discloses a method for detecting a CNV marker of an HMGA2 gene of Suzhou Lake mutton sheep, the CNV marker refers to copy number variation in a candidate region chr3: 154132689-154135563 of the HMGA2 gene of the Suzhou Lake mutton sheep, Suzhou Lake mutton sheep genome DNA is taken as a template, a normal double-copy gene ANKRD1 is taken as a reference gene, the HMGA2 gene of the Suzhou Lake mutton sheep and partial fragments of the reference gene are respectively amplified through fluorescent quantitative PCR, and the CNV marker is used for detecting the HMGA2 gene of the Suzhou Lake mutton sheep. Dividing the Suhu Lake mutton sheep individuals into an increase type, a deletion type and a normal type according to the quantitative result of 2 * 2 delta delta Ct. The CNV marker closely related to the body length character of the Suzhu mutton sheep is detected on the DNA level and is applied to molecular marker-assisted selection of the growth character of the Suzhu mutton sheep, so that the genetic breeding process of the Suzhu mutton sheep is accelerated.
Owner:YANGZHOU UNIV +2

InDel marker of pig growth rate related gene RPS27L and application thereof

The application discloses application of an InDel molecular marker or a substance for detecting the InDel molecular marker in identification or auxiliary identification of pig growth rate, and the InDel molecular marker is a DNA molecule with a nucleotide sequence as shown in SEQ ID No. 1. The application has beneficial effects, including: (1) the application finds that an insertion / deletion site in a pig RPS27L gene promoter region can be used as a genetic selection marker for pig molecular breeding, and is beneficial to screening of pig breeds with excellent growth traits and acceleration of speed of selection and breeding of fine breeds; (2) the application uses a primer pair P1 designed according to a whole genome of a reference pig as a primer, uses pig genomic DNA as a template, and detects a genotype of an insertion / deletion polymorphism site (Chr1:108,880,114-108,880,126bp) in a pig RPS27L gene promoter region in a pig population through sequence amplification, electrophoretic identification and Sanger sequencing, and the detection is efficient, accurate and low in cost.
Owner:AGRICULTURAL GENOMICS INSTITUTE AT SHENZHEN CHINESE ACADEMY OF AGRICULTURAL SCIENCES (SHENZHEN BRANCH GUANGDONG LABORATORY FOR LINGNAN MODERN AGRICULTURE)

Application of molecular marker related to chicken feed intake in chicken genetic breeding

The invention provides application of a molecular marker related to chicken feed intake in chicken genetic breeding, and belongs to the technical field of animal genetic breeding and biology, and the molecular marker related to the chicken feed intake comprises FIchr241 and / or FIchr242; the FIchr241 corresponds to the 2966999 site of chromosome 24 in the version sequence information of a chicken reference genome bGalGal1. Mat.broil.GRCg7b published in NCBI (National Center of Biotechnology Information), and belongs to the 24th exon sequence of a gene GRAMD1B, and the basic group at the site is G or A and is synonymous mutation; the FIchr242 corresponds to the 3295470th site of the 24 # chromosome of the same version of sequence information and belongs to the gene lncRNA intron sequence, and the basic group at the site is T or C. The FIchr241 or the FIchr242 is beneficial to breeding of chicken varieties efficiently utilizing feed, and the purpose of increasing chicken raising income is achieved by reducing feed intake.
Owner:JIANGSU INST OF POULTRY SCI

SNP molecular marker related to cashmere fineness trait and application thereof

PendingCN122357738AFisheryZoology
This invention discloses a SNP molecular marker associated with the fineness trait of cashmere. This SNP marker is a C>T base mutation located at 93908315 bp on chromosome 10 of the goat genome (ARS 1.0 version). This molecular marker can be applied to the breeding of cashmere fineness traits, the development of fine-cash goat breeds, the improvement of cashmere fineness traits in goat populations, and the evaluation or screening of goat cashmere production performance. Therefore, it can improve the quality of goat cashmere fineness, accelerate the genetic selection process for cashmere fineness performance, and effectively enhance the cashmere value and production efficiency of goats.
Owner:INNER MONGOLIA UNIV FOR THE NATITIES

A method for identifying rapid gonadal development in the Chinese mitten crab.

This invention provides a method for identifying rapid gonadal development in Chinese mitten crabs, belonging to the field of genetic selection and aquaculture technology for Chinese mitten crabs. The method includes a step of detecting the base type of a gene locus at position 1458867 on chromosome 38 of the Chinese mitten crab genome version ASM1343648v1 to determine whether the genotype of the gene locus is CC, CT, or TT. This facilitates the selection and breeding of Chinese mitten crabs with the CC genotype, which exhibit the most rapid gonadal development trait, thereby meeting long-term market demand and improving the aquaculture profitability of Chinese mitten crabs.
Owner:FRESHWATER FISHERIES RES INSITUTE OF JIANGSUPROVINCE

Application of MrDNAJB13 gene in regulating drought resistance of hairy roots of Medicago truncatula

This invention discloses the application of the MrDNAJB13 gene in regulating the drought resistance of hairy roots in alfalfa beans, belonging to the field of biotechnology. This invention discovers that overexpression of the MrDNAJB13 gene yields hairy roots with enhanced drought resistance. Furthermore, this invention constructs a MrDNAJB13 gene overexpression vector and a hairy root transformation method for alfalfa bean hairy root systems. The transformation method of this invention for alfalfa bean hairy root transformation can serve as a biotechnological means for studying the function of drought-resistant genes in alfalfa beans, and may be extended to other fields, including the study of stress resistance mechanisms, laying the foundation for the verification of alfalfa bean gene function and genetic selection.
Owner:LANZHOU UNIV

A molecular marker related to good feed utilization trait of gibel carp and application thereof

The application discloses a molecular marker related to excellent feed utilization of Procyprinus prolocus and application. The molecular marker is located on chromosome 15 of the Procyprinus prolocus, and contains one SNP site kmt2e-1 on the molecular marker; the SNP site kmt2e-1 is located at the 10368245th base of the chromosome 15 of the Procyprinus prolocus, and the polymorphic site is C / T. The application realizes SNP typing based on the feed utilization of the Procyprinus prolocus for the first time, and improves the accuracy and efficiency of genetic selection.
Owner:HUAZHONG AGRI UNIV

SNP (Single Nucleotide Polymorphism) marker related to white feather broiler egg weight character and application thereof

The invention discloses an SNP (Single Nucleotide Polymorphism) marker related to a white feather broiler egg weight character and an application of the SNP marker. The four SNP markers provided by the invention have obvious influence on the white feather meat breeding egg weight character, can improve the genome prediction accuracy, are beneficial to accelerating the genetic improvement of the white feather meat breeding egg weight character, can be used for genetic breeding of egg weight, and are simple to operate and reliable in result.
Owner:INSTITUTE OF ANIMAL SCIENCES OF CHINESE ACADEMY OF AGRICULTURAL SCIENCES