57 results about "Genetic selection" patented technology

The invention discloses a tuna pond culture strategy optimization method and system based on meteorological influence analysis, and the method comprises the steps: collecting regional meteorological data and pond culture monitoring data, and constructing a multi-modal pond ecological feature vector; establishing a weather-water body dynamic coupling model by using a space-time diagram neural network, and generating water body situation response prediction information; a breeding regulation and control strategy is made based on the prediction information, and strategy self-adaptive optimization is achieved through real-time monitoring data; evaluating the anti-disaster capability of the tuna after the meteorological influence is finished, screening high-quality germplasm resources by combining genetic analysis, and generating an anti-disaster breeding scheme. According to the method, full-chain optimization from meteorological early warning to culture regulation and control to genetic breeding is achieved, and the climate toughness and economic benefits of tuna pond culture are comprehensively improved.

The invention is applicable to the technical field of rabbit breeding, and provides a method for increasing the body weight of a rabbit based on a gene editing technology, which comprises the following steps: designing an action target sgRNA on a rabbit NR6A1 gene aiming at an NR6A1 p.P192S site; uniformly mixing the synthesized sgRNA and SpRY-CBE, injecting fertilized eggs, transplanting the fertilized eggs into fallopian tubes of receptor female rabbits, and feeding the receptor female rabbits until production; dNA is extracted from produced young rabbit ear tissues, PCR and sequencing are carried out, and if C at the fifth site in NR6A1 gene target sites is mutated into T, it is proved that single base mutation is obtained, and the NR6A1 gene edited rabbit is obtained. According to the invention, the rabbit variety with increased weight is successfully cultivated; a new thought of animal genetic breeding is developed by utilizing a gene editing technology, the method has application values in promoting improvement of genetic characters of rabbits and improving production performance and economic value of the rabbits, and powerful support is provided for high-quality development of the animal breeding industry in China.

The invention discloses a molecular marker related to excellent feed utilization characters of siniperca chuatsi and application. The molecular marker is located on a No.15 chromosome of siniperca chuatsi, and the molecular marker contains one SNP (Single Nucleotide Polymorphism) site kmt2e-1; the SNP site kmt2e-1 is located at the 10368245th basic group of the No.15 chromosome of siniperca chuatsi, and the polymorphic site is C / T. According to the invention, SNP typing based on feed utilization characters is realized in siniperca chuatsi for the first time, and the accuracy and efficiency of genetic breeding are improved.

The invention belongs to the technical field of molecular biology, particularly relates to a pig chromosome 3 TMC7 gene as a meat-producing character molecular breeding marker and application, and aims to provide a new marker and technical support for meat-producing character molecular breeding of pigs. The molecular marker is located at the 26346502 base in a pig chromosome 3 TMC7 gene, and allele G / T polymorphism exists at the site. A correlation analysis result shows that in American and French large white pig populations, the eye muscle area of a GG genotype individual is remarkably higher than that of other genotype individuals (plt; 0.05), and it is indicated that the genotype is a favorable genotype of the eye muscle area character. The SNP marker provided by the invention provides a new molecular tool for genetic breeding of pig eye muscle area characters, and can be used for auxiliary screening of breeding pigs with excellent meat production performance, so that the breeding process of pig breeds with high lean meat percentage is accelerated.

The invention relates to the technical field of genetic breeding, and discloses a method for stabilizing the chemical property of a subtropical silkworm mid-line variety, which comprises the following steps: screening an egg circle with the optimal chemical property from a production group to establish an initial group; second-generation frame seed production is obtained through incubation and single moth breeding in combination with comprehensive screening of pupa unified life rate, cocoon quality and offspring hatching rate; single moth breeding screening is repeated twice, and third-generation and fourth-generation frame seed production is obtained; adopting a 4 / 4 moth area mixed breeding method to obtain five-generation frame seed production; then five-generation frame seed production is used as a new starting point, the breeding and screening processes are repeatedly executed, each time 4 / 4 moth area mixed breeding is executed as a breeding cycle, and at least two breeding cycles are continuously executed until a new silkworm strain with the sum of the seed generation rate and the re-egg-out rate stably lower than 0.5% is obtained. The method is used for cultivating new silkworm strains which are stable in chemical property and maintain excellent economic characters and robustness, and provides support for stable development of the silkworm industry.

The invention provides a regional layout optimization method and device, equipment and a medium, and the method comprises the steps: initializing layout limitation information, product combination information and product technological process information, and randomly generating an initialized layout scheme; optimizing the initialized layout scheme by using a genetic algorithm to obtain an optimal layout scheme; in each round of iteration process, the following steps are executed: calculating the fitness of the first layout schemes, and performing genetic selection from the first layout schemes according to the fitness to obtain a second layout scheme; performing crossover variation on the second layout scheme to obtain a third layout scheme; judging whether an iteration stopping condition is met or not, and if yes, outputting an optimal layout scheme; and otherwise, carrying out the next round of iteration until an iteration stopping condition is met. The initial group is automatically generated by using the genetic algorithm, the subjectivity of manual drawing of the position correlation graph is eliminated, the subjectivity of optimization actions and the limitation of the number of optimization samples in the manual calculation process are eliminated, time and manpower are saved, and efficiency is improved.

The present invention discloses a skin mucus protein molecular marker for accurately quantifying the alkalinity stress level of fish and a detection method thereof, belonging to the technical field of fish alkali tolerance. The present invention aims to solve the problem that there is currently a lack of protein molecular markers for the alkalinity stress level of fish, which in turn affects the efficiency of fish alkali tolerance breeding and selection. The present invention provides a marker for identifying carp fish with alkali tolerance, and the amino acid sequence of the marker is shown in SEQ ID NO.1. It will provide important support for the genetic breeding and selection of alkali-tolerant fish such as grass carp, crucian carp, and Leuciscus waleckii, and further promote the fishery development and utilization of medium and high-saline-alkali waters.

The invention relates to the field of molecular markers, and particularly provides miRNA (micro Ribonucleic Acid) related to the egg yield of Melopsis undulata and application of the miRNA. According to the present invention, the high-throughput sequencing technology and the miRNA-mRNA association analysis are adopted to screen the related miRNA for regulating and controlling the parrot egg laying traits, the miRNA is mun-miR-367-3p, the nucleotide sequence of the miRNA is AAUUGCACUUAGCAAUGGUG, and the miRNA can be adopted as the molecular marker related to the parrot egg laying amount, and has important practical application value in the genetic breeding of the parrot egg laying amount traits.

The present application belongs to the field of molecular biology technology and breeding of Muxuan black-bone chickens, and particularly relates to a PMEL17 gene for breast muscle blackness of Muxuan black-bone chickens and a genetic marker method thereof. The nucleotide sequence of the gene is shown as SEQ ID NO. 1. The marker method is to design a primer pair, take the genomic DNA of Muxuan black-bone chickens as a template, perform PCR amplification, obtain a sequence shown as SEQ ID NO. 4, identify whether the sequence has a mutation, and analyze the correlation between the mutation and the breast muscle blackness of Muxuan black-bone chickens. The screened gene is a gene related to the breast muscle blackness of Muxuan black-bone chickens, and further screening of a SNP related to the trait at a 553th site of the PMEL17 gene sequence can be used as a genetic marker for auxiliary selection of Muxuan black-bone chickens. Through the genetic marker, Muxuan black-bone chickens with more melanin deposition and darker color can be selected and bred, which has important significance and application value for the genetic breeding of Muxuan black-bone chickens.

To provide an SNP marker composition for predicting high water temperature tolerance of olive flounder, and a method for predicting high water temperature tolerance of olive flounder using the same.SOLUTION: An SNP marker composition for predicting high water temperature tolerance of olive flounder according to the present disclosure includes one or more selected from the group consisting of polynucleotides composed of 10 to 100 consecutive nucleotides, or polynucleotides complementary thereto, each containing a predetermined SNP at a predetermined position in a polynucleotide composed of a nucleotide sequence of SEQ ID NOs: 1 to 30. The SNP marker composition of the present disclosure can be utilized for genetic selection of olive flounder having tolerance to high water temperature, and can promote development of high water temperature-tolerant varieties and sustainable production.SELECTED DRAWING: Figure 4a

The invention belongs to the technical field of molecular markers, and particularly relates to an InDel marker linked with salt tolerance of millet in the germination period and application of the InDel marker, the nucleotide sequence of the InDel marker is shown as SEQ ID NO.1, and G or GGCAGCCACCACA is located at the 301st basic group. The invention discloses an InDel molecular marker linked with the salt tolerance of millet in a germination period. The salt tolerance of the millet in the germination period can be subjected to good typing by utilizing the InDel molecular marker. According to the polymorphism difference, the molecular marker can be used for molecular marker-assisted breeding of the salt tolerance of the millet in the germination period, molecular-assisted technical support is provided for early identification and screening breeding of the salt tolerance of the millet in the germination period, and the molecular marker has important theoretical and practical guiding significance for accelerating genetic breeding of salt-tolerant millet varieties.

The application belongs to the technical field of poultry breeding, and discloses siRNA for targeted inhibition of chicken PLCD4 gene expression and application thereof; the siRNA comprises PLCD4-853, PLCD4-528 and PLCD4-1870; the siRNA for targeted inhibition of chicken PLCD4 gene expression can effectively reduce the expression of the chicken PLCD4 gene after being introduced into chicken primary subcutaneous adipocytes, and the inhibition efficiency is more than 50%, and the knockdown efficiency is very high; the siRNA can be used for identifying gene functions by specifically knocking down the expression of the chicken PLCD4 gene in vitro, and can be applied to genetic selection of high-quality broiler subcutaneous fat deposition as a molecular marker, and has great economic value and scientific research value.

To provide an SNP marker composition for predicting high water temperature tolerance of olive flounder, and a method for predicting high water temperature tolerance of olive flounder using the same.SOLUTION: An SNP marker composition for predicting high water temperature tolerance of olive flounder according to the present disclosure includes one or more selected from the group consisting of polynucleotides composed of 10 to 100 consecutive nucleotides, or polynucleotides complementary thereto, each containing a predetermined SNP at a predetermined position in a polynucleotide composed of a nucleotide sequence of SEQ ID NOs: 1 to 30. The SNP marker composition of the present disclosure can be utilized for genetic selection of olive flounder having tolerance to high water temperature, and can promote development of high water temperature-tolerant varieties and sustainable production.SELECTED DRAWING: Figure 4a

The invention relates to the technical field of poultry genetic breeding and biology, in particular to a DGKA gene molecular marker for laying hen egg-laying persistent breeding, application and a method, and belongs to the technical field of molecular marker-assisted breeding. The molecular marker is located on a No.34 chromosome of a chicken reference genome bGalGal1. Mat.broil.GRCg7b, the 1334260th site has G / A polymorphism and is located in a 5 '-UTR region of a DGKA gene, and the SNP can be used as the molecular marker and is used for early genetic breeding of high-egg-yield persistent laying hens. The molecular marker is applied to early screening and genetic breeding of high-egg-yield persistent laying hens, breeding accuracy and breeding efficiency can be remarkably improved, phenotype determination cost is reduced, and the molecular marker has important economic value and popularization and application prospects for promoting efficient and precise development of the laying hen industry.

To provide an SNP marker composition for predicting high water temperature tolerance of olive flounder, and a method for predicting high water temperature tolerance of olive flounder using the same.SOLUTION: An SNP marker composition for predicting high water temperature tolerance of olive flounder according to the present disclosure includes one or more selected from the group consisting of polynucleotides composed of 10 to 100 consecutive nucleotides, or polynucleotides complementary thereto, each containing a predetermined SNP at a predetermined position in a polynucleotide composed of a nucleotide sequence of SEQ ID NOs: 1 to 30. The SNP marker composition of the present disclosure can be utilized for genetic selection of olive flounder having tolerance to high water temperature, and can promote development of high water temperature-tolerant varieties and sustainable production.SELECTED DRAWING: Figure 4a

The present invention relates to a cereal plant comprising an engineered alien addition chromosome carrying a male fertility restorer gene and a co-segregating set of genes contributing to a color characterized by a low misdivision rate. Further the present invention relates to a cell, a seed, or a progeny or part thereof of the cereal plant comprising said male fertility restorer gene and said set of genes. The invention also relates to a method for selecting and / or sorting at least one male-sterile female seed of a cereal plant. The present invention also relates to a method of generating a color-coded male sterile system for phenotypic and / or genetic selection of cereal plants. Further the present invention relates to an engineered alien addition chromosome carrying the above mentioned structural features.

The application discloses an intelligent control method and system based on a high-voltage transformer substation and electronic equipment, the method comprising the following steps: reading corresponding recording wave data from a database in response to a pre-warning message sent by a region to be monitored, so as to determine a recording wave feature vector set according to the recording wave data; selecting Q initial populations from M groups of original data at any time based on each feature in the recording wave feature vector set; initializing the number of iterations, calculating the fitness value of each individual in each initial population based on a target function; outputting the individual with the highest fitness value as the optimal individual of the current population through genetic selection, so as to determine one or more elements associated with the optimal individual; marking a fault or a risk according to the number of elements; and controlling the disconnection of a fault element or a line to troubleshoot the fault element or the fault line. The application can retain elements with higher risk probabilities, and eliminate calculation errors and complexity caused by recording wave data redundancy.

The invention belongs to the technical field of molecular markers, and particularly discloses a molecular marker primer for detecting the shank girth of a cast chicken and application of the molecular marker primer, and the molecular marker primer is characterized in that 300-day-old shank girth-related phenotype determination and whole genome re-sequencing are carried out on 297 cast chicken-Yao chicken F2 generation resource group individuals (the average sequencing depth gt of the individuals; the molecular marker Chr1: 68713248 (GRCg7b) has the advantages that the molecular marker Chr1: 68713248 (GRCg7b), which is excavated by carrying out whole genome correlation analysis on the molecular marker Chr1: 68713248 (GRCg7b), has extremely high genetic correlation with 300-day-old shin girth, and is very remarkable in genetic effect, so that the molecular marker Chr1: 68713248 (GRCg7b) can be effectively used for molecular marker-assisted selective breeding of Dast chicken thick shin girth related specialized strain breeding, individuals with the molecular marker Chr1: 68713248 (GRCg7b) sites being AA or AT genotypes are selected as breeding hens, and the breeding hens can be bred and the genetic selection progress of Dongshin chicken containing Dongshin chicken blood relationship related specialized strain Dongshin chicken can be accelerated.

The invention discloses SNP and KASP markers closely linked with the number of corn tassel branches and application of the SNP and KASP markers, and belongs to the technical field of molecular marker-assisted breeding. The invention provides an SNP (Single Nucleotide Polymorphism) marker and a KASP (Kinase Associated Specific Protein) marker which are closely linked with the number of corn tassel The SNP is located at 24904636bp of a chromosome 3 of a V4 version of the B73 genome; the forward primer of the KASP marker is 1TBN23-KASP-106F1 and the forward primer of the KASP marker is 1TBN23-KASP-106F2, and the reverse primer of the KASP marker is 1TBN23-KASP-106R; the provided SNP and KASP markers can be used for good typing of the corn tassel branch number, can be used for identification of the character of the corn tassel branch number and molecular marker-assisted breeding, and have important theoretical and practical guiding significance for accelerating the genetic breeding and improvement process of corn varieties.

The application belongs to the technical field of poultry breeding, and discloses siRNA for targeted inhibition of chicken ULK2 expression and application thereof; the siRNA comprises ULK2-1170; the siRNA for targeted inhibition of chicken ULK2 gene expression can effectively reduce the expression of the chicken ULK2 gene after being transferred into chicken primary myoblast cells, the inhibition efficiency is more than 50%, and the knockdown efficiency is very high; the siRNA can be used for identifying gene functions by specifically knocking down the expression of the chicken ULK2 gene in vitro, and can be applied to genetic selection of high-quality broiler leg muscle development as a molecular marker, and has great economic value and scientific research value.

The invention relates to the technical field of plant molecular breeding, in particular to an indel marker PH-03-Idel-106 related to the plant height character of corn and application of the indel marker PH-03-Idel-106 related to the plant height character of the corn, the Indel marker is located in the area of the third chromosome Chr3: 163962052-163964052 of the corn and is a 7bp insertion / deletion polymorphism marker, a 7bp insertion sequence CTGAGGG exists in a high-stalk corn inbred line, and no insertion sequence exists in a dwarf corn inbred line. A matched specific primer pair PH-03-Indel-106F / R can specifically amplify a target area, 1.5% agarose gel electrophoresis detection is carried out, it is judged that the corn plant height marker is a dwarf haplotype when a 270bp band appears, it is judged that the corn plant height marker is a high-stalk haplotype when no band exists, and the marker can be used for molecular marker-assisted selection, breeding improvement and early identification and screening of the corn plant height character. Phenotypes can be accurately predicted through DNA detection in the seedling stage, and environmental interference is avoided. The method has the advantages of being high in specificity, simple and convenient to detect, low in cost, high in throughput and the like, the breeding period can be remarkably shortened, directional improvement of the plant height character is achieved, and the method has important significance on corn variety genetic breeding and plant type optimization.

The invention belongs to the technical field of poultry breeding, and discloses siRNA for targeted inhibition of chicken FTO expression and application thereof. The siRNA comprises FTO-858 (Fluorine Doped The siRNA can inhibit the expression of the chicken FTO gene in a targeted manner, after the siRNA is transferred into chicken primary intramuscular fat cells, the expression of the chicken FTO gene can be effectively reduced, the inhibition efficiency reaches 50% or above, and the knock-down efficiency is very high; the siRNA identifies the gene function by specifically knocking down the expression of the chicken FTO gene in vitro, can be used as a molecular marker to be applied to genetic breeding of intramuscular fat deposition of high-quality broilers, and has great economic value and scientific research value.

The application belongs to the technical field of poultry breeding, and discloses siRNA for targeted inhibition of chicken PLCB2 gene expression and application thereof; the siRNA comprises PLCB2-409, PLCB2-2566 and PLCB2-3239; the siRNA for targeted inhibition of chicken PLCB2 gene expression can effectively reduce the expression of the chicken PLCB2 gene after being converted into chicken primary subcutaneous adipose cells, and the inhibition efficiency is more than 50%; the siRNA can be used for identifying gene functions by specifically knocking down the expression of the chicken PLCB2 gene in vitro, and can be applied to genetic selection of high-quality broiler subcutaneous fat deposition as a molecular marker, and has great economic value and scientific research value.

To provide an SNP marker composition for predicting high water temperature tolerance of olive flounder, and a method for predicting high water temperature tolerance of olive flounder using the same.SOLUTION: An SNP marker composition for predicting high water temperature tolerance of olive flounder according to the present disclosure includes one or more selected from the group consisting of polynucleotides composed of 10 to 100 consecutive nucleotides, or polynucleotides complementary thereto, each containing a predetermined SNP at a predetermined position in a polynucleotide composed of a nucleotide sequence of SEQ ID NOs: 1 to 30. The SNP marker composition of the present disclosure can be utilized for genetic selection of olive flounder having tolerance to high water temperature, and can promote development of high water temperature-tolerant varieties and sustainable production.SELECTED DRAWING: Figure 4a

The present invention is applicable to the field of rabbit breeding technology and provides a method for increasing rabbit weight based on gene editing technology, comprising: designing a target sgRNA for the NR6A1 p.P192S site on the rabbit NR6A1 gene; mixing the synthesized sgRNA and SpRY‑CBE, injecting the resultant sgRNA into a fertilized egg, transplanting the mixture into the oviduct of a recipient female rabbit, and raising the recipient female rabbit until birth; extracting DNA from the ear tissue of the resulting young rabbit, performing PCR and sequencing, and if the C at position 5 in the NR6A1 gene target site mutates to T, a single base mutation is obtained, i.e., an NR6A1 gene-edited rabbit is obtained. The present invention successfully breeds a rabbit breed with increased weight; utilizing gene editing technology to develop new ideas for animal genetic breeding, has application value in promoting the improvement of rabbit genetic traits, enhancing rabbit production performance and economic value, and provides strong support for the high-quality development of my country's animal seed industry.

The application discloses a SNP (Single Nucleotide Polymorphism) closely linked with the number of tassel branches of corn, a KASP (Kompetitive Allele Specific PCR) marker and application thereof, and belongs to the technical field of molecular marker assisted breeding.The application provides a SNP and a KASP marker closely linked with the number of tassel branches of corn; the SNP is located at 24904636bp of a No.3 chromosome of a V4 version of a B73 genome; the forward primer of the KASP marker is 1TBN23-KASP-106F1 and 1TBN23-KASP-106F2, and the reverse primer is 1TBN23-KASP-106R; the provided SNP and KASP marker can be used for good typing of the number of tassel branches of corn, and can be used for identification of the number of tassel branches of corn and molecular marker assisted breeding, and has important theoretical and practical guiding significance for accelerating the genetic breeding and improvement process of corn varieties.

The invention belongs to the technical field of molecular assisted selective breeding, and provides an SNP marker combination applicable to anti-flow breeding of pseudosciaena crocea, the SNP marker comprises 1000 SNP molecular markers, and the information of the 1000 SNP molecular markers is shown in a table 1. The progeny pseudosciaena crocea bred by using the SNP marker combination is excellent in flow resistance, and has extremely high genetic selection potential and breeding application value. The SNP marker combination as an efficient molecular tool for anti-flow breeding of the large yellow croaker can be directly applied to the breeding industry, the breeding period is greatly shortened through marker-assisted selection, anti-flow progeny is rapidly cultivated, and the SNP marker combination is particularly suitable for deep and far sea breeding scenes with complex water flow environments, so that a breakthrough solution is provided for anti-flow breeding of the large yellow croaker; the method is of great significance to promotion of mariculture variety improvement and deep and far-reaching mariculture industry development, and has wide application prospects and remarkable commercial value.

The invention provides a breeding method for improving fish muscle fat content and application, and belongs to the technical field of gene editing breeding. The breeding method for improving the fish muscle fat content comprises the steps that a gene editing technology is adopted for knocking out osteomodulatory protein genes of fishes, so that the osteomodulatory protein genes form frame-shift mutation or early translation termination, and osteomodulatory protein gene mutants are obtained. According to the breeding method for increasing the fish muscle fat content, the osteomodulatory protein gene of the fish is knocked out in a gene editing mode, the fish muscle fat content can be remarkably increased, and the growth of the fish is not affected. The osteomodulatory protein gene can be used as a gene target of genetic breeding and gene editing breeding, and a breeding method for increasing the muscle fat content of fish based on the gene target can be applied to fish breeding and has important significance for cultivating new fish varieties with high muscle fat content.

The invention discloses circFTO related to beef cattle intramuscular fat generation and application of circFTO, and relates to the technical field of beef cattle intramuscular fat generation. The nucleotide sequence of the circFTO is as shown in SEQ ID NO: 1. The existence of circFTO is verified, the full length of the molecular sequence of the circular RNA is obtained through cloning, the circFTO ring structure is determined, and the molecule has resistance to exonuclease RNase R. The circFTO regulates beef cattle intramuscular fat generation to influence the beef quality, and is applied to an auxiliary genetic breeding process in the aspect of beef quality improvement. The circFTO disclosed by the invention can be used as a molecular marker related to beef quality, and has an important practical application value in genetic assisted breeding.

The invention belongs to the technical field of poultry breeding, and discloses siRNA for targeted inhibition of chicken IMPAD1 expression and application thereof. The siRNA comprises IMPAD1-591 (IMPAD1-591 The siRNA can inhibit the expression of the chicken IMPAD1 gene in a targeted manner, after the siRNA is transferred into chicken primary myoblasts, the expression of the chicken IMPAD1 gene can be effectively reduced, the inhibition efficiency reaches 50% or above, and the knock-down efficiency is very high; the siRNA identifies the gene function by specifically knocking down the expression of the chicken IMPAD1 gene in vitro, can be used as a molecular marker to be applied to genetic breeding of breast muscle development of high-quality chicken, and has great economic value and scientific research value.