Microsatellite marking method applicable to parentage determination of hard clam

A technology of microsatellite markers and microsatellites, which is applied in the field of molecular assistance in genetic breeding, can solve problems such as few reports of successful applications, and achieve the effect of feasible design principles, simple marking methods, and good practicability

Inactive Publication Date: 2012-10-10
INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF0 Cites 11 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

[0004] Using molecular marker technology to establish a set of microsatellite marker family identification system suitable for clams, to provide powerful tools for maintaining family information, determining kinship, and tracking families in selection and breeding, and laying a good foundation for breeding planning of clams is a technical field Researchers are trying to explore the method, but there are few reports on the successful application of this method in clam breeding

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Microsatellite marking method applicable to parentage determination of hard clam
  • Microsatellite marking method applicable to parentage determination of hard clam
  • Microsatellite marking method applicable to parentage determination of hard clam

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0039] 1) The source of microsatellite loci: extract the genomic DNA of Meretrix meretrix, the extraction method is as follows:

[0040]Take a tissue less than 30mg, cut it into as small pieces as possible, add it to a 1.5ml Eppendorf tube, then add 500μL of cell lysate and 5μL of 20mg / ml proteinase K, shake gently, and lyse at 65°C for 4h. Then, 600 μL of phenol:chloroform:isoamyl alcohol (volume ratio 25:24:1) mixture was added to the lysed sample, shaken for 20 minutes, centrifuged at 12000 rpm for 10 minutes, and the supernatant was taken. Then add phenol: chloroform: isoamyl alcohol mixture, repeat the above operation 2 times. Then take the supernatant, add 2 times the volume of cooled absolute ethanol and 1 / 10 of the supernatant volume of 3mmol / L sodium acetate, centrifuge at 12000rpm for 10min, discard the supernatant, keep the DNA precipitate, and wash twice with 70% ethanol After the ethanol evaporated completely, the DNA was dissolved in TE buffer and stored in a re...

Embodiment 2

[0048] This embodiment is divided into three steps of extracting clam genomic DNA, PCR amplification and electrophoresis detection of PCR products:

[0049] Extract clam DNA: select clam X 7 S 27 Take 30 mg of fresh tissue from each individual of the family’s parents and 30 offspring, cut it into pieces and add it to a 1.5ml Eppendorf tube, then add 500 μL of cell lysate and 5 μL of 20 mg / ml proteinase K, shake gently, and leave overnight at 37°C . Then add 600 μL of phenol:chloroform:isoamyl alcohol (volume ratio 25:24:1) mixture to the lysed sample, shake for 20 minutes, centrifuge at 12000 rpm for 10 minutes, and take the supernatant. Then add phenol: chloroform: isoamyl alcohol mixture, repeat the above operation 2 times. Then take the supernatant, add 2 times the volume of cooled absolute ethanol and 1 / 10 volume of 3mmol / L sodium acetate, centrifuge at 12000rpm for 10min, discard the supernatant, keep the DNA precipitate, wash twice with 70% ethanol, and wait After th...

Embodiment 3

[0056] Using the microsatellite marking method of the present invention to carry out microsatellite marking site MMF68 in clam X 7 S 27 Types in the parents and their 5 offspring in the family, offspring numbers 1, 3, 17, 29, 56 (see figure 1 ):

[0057] (1) Source of microsatellite loci: Genomic DNA of clams was extracted, genomic DNA fragments of clams were obtained by restriction endonuclease method, microsatellite magnetic bead enrichment library was constructed, positive clones were detected, and microsatellite repeats were obtained by sequencing the DNA sequence;

[0058](2) Primer design: Use the software Primer Premier 5.0 to design primers at the flanking sequences of the microsatellite repeats. The primer design conditions are: the primer length is 19-25mer; the GC content is 40%-60%; the annealing temperature is 45-65°C; The expected PCR product length is 100-400bp; the MMF68 primer is F: TGAGATGAGACCCTGTGTTAC; R: AAGCAATGATTCTTCACCTAA.

[0059] (3) Primer optim...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a molecular assisted technology for genetic breeding, in particular to a microsatellite marking method applicable to parentage determination of hard clam. The microsatellite marking method comprises four steps of obtaining microsatellite loci source, designing a primer, optimizing the primer and establishing a microsatellite marker parentage determination system, and the specific process is as follows: firstly using a bead enriching library method to screen microsatellite sequences, and using a microsatellite retrieval software to carry out rapid separation of microsatellite fragments; designing a primer on a microsatellite repeated flanking sequence, optimizing the primer and leading the primer to become a microsatellite marker; then carrying out a comprehensive evaluation on repeatability, stability and polymorphism information content value during the amplification process of the microsatellite marker, and determining the microsatellite markers therein as the microsatellite parentage determination system of the hard clam for differentiation among different parentages of the hard clam or identification and determination among individuals. According to the invention, a molecular marking method for genetic breeding of the hard clam is provided.

Description

technical field [0001] The invention relates to a molecular auxiliary technology for genetic breeding, in particular to a microsatellite marking method suitable for clam family identification. Background technique [0002] Family selection is an effective method for cultivating new varieties in the breeding room. Systematic selection through the establishment of families is an important means of genetic breeding and has achieved extensive success in animals and plants. Complete and accurate pedigree information will have a great impact on the breeding process, and the inability to accurately confirm the genetic relationship between individuals will lead to a decrease in genetic progress during the breeding process. It is of great significance to correct the parent-child relationship and correct the wrong pedigree information through paternity testing to promote the improvement of varieties. At the same time, in the process of artificial stocking and release, in order to red...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/68
Inventor卢霞王鸿霞刘保忠
OwnerINST OF OCEANOLOGY - CHINESE ACAD OF SCI