Growth-related molecular marker in C-type scavenger receptor of Litopenaeusvannamei and application

A technology related to molecular markers and scavenger receptors, applied in the determination/testing of microorganisms, biochemical equipment and methods, DNA/RNA fragments, etc., can solve the problem of low marker density, no genes or markers directly related to growth and other issues to achieve the effect of improving efficiency and accuracy

Active Publication Date: 2018-12-21
INST OF OCEANOLOGY - CHINESE ACAD OF SCI
View PDF1 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

In the early stage, the researchers mapped some QTL loci related to growth traits in Penaeus prawns by QTL mapping method. Growth-related gene ELOVL (Elongation of very long chain fatty acids-like) (Lyons RE, Dierens LM, TanSH, Preston NP, Li Y. Characterization of AFLP markers associated with growth in the kuruma prawn, Marsupenaeus japonicus, and identification of a candidate gene .Mar Biotechnol, 2007,9:712-721); In the QTL location of Litopenaeus vannamei, also found the growth-related QTL locus (Andriantahina F, Liu X, Huang H. Genetic map construction and quantitative trait locus (QTL) detection of growth-related traits in Litopenaeus vannamei for selective breeding applications.PLoS One,2013,8:e75206), but limited by the low marker density, no genes or markers directly related to growth were located

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Growth-related molecular marker in C-type scavenger receptor of Litopenaeusvannamei and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0017] Example 1: Obtaining growth-related molecular markers of Litopenaeus vannamei

[0018] (1) Genome-wide association analysis (GWAS) of growth traits of Litopenaeus vannamei:

[0019] The material used for GWAS analysis was a mixed population consisting of 13 full-sib families. In July 2015, a total of 13 full-sib families were constructed in Hainan Guangtai Ocean Breeding Co., Ltd. (Wenchang, Hainan) through directional mating. After each family hatched the larvae, they were transferred to 5m 2 The ponds are cultivated separately. During this period, in order to reduce the impact of the breeding environment on different families, we tried our best to adopt a standardized way to cultivate each family, so that the conditions such as salinity, temperature, larvae density, bait and aeration were as consistent as possible. In September 2015, 50 prawns were randomly selected from each of 13 families and mixed and transferred to 10m 2 The pools were cultivated in a unified ...

Embodiment 2

[0036] Example 2: Application of a growth-related marker of Litopenaeus vannamei in breeding.

[0037] (1) Typing of the LvSRC-211-G / T loci of the candidate parents

[0038] In June 2016, using the reserved broodstock of Hainan Guangtai Ocean Breeding Company (Wenchang, Hainan) as the candidate parents, the DNA was extracted from a pair of swimming legs of each prawn, and the following primers were used to amplify the DNA of each individual Target area sequence:

[0039] LvSRCF: CCGTATTTGTTGAATGAGTGGG

[0040] LvSRCR: CTACCACTCCAACAGACGAAGG

[0041] The PCR amplification products were sequenced using ABI3730xl sequencer, and the sequencing primers were LvSRCF primers, and the LvSRC-211-G / T was typed according to the sequencing peak map. If there was only one G base peak at this position, the typing result It is GG type. If there is only one T base peak, the typing result is TT type. If there are both G base peaks and T base peaks at this position, the typing result is GT ty...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention belongs to the technical field of aquatic breeding, and particularly relates to a growth-related molecular marker in a C-type scavenger receptor gene (LvSRC) of Litopenaeusvannamei and application thereof to genetic breeding of the Litopenaeusvannamei. A batch of markers related to shrimp growth traits are positioned in the genomic level through genome-wide association analysis, a single nucleotide polymorphism (SNP) marker (LvSRC-211-G / T) positioned in a coding region of the LvSRC gene is further screened through gene annotation and by a candidate gene association analysis method, and the genotype of the marker is significantly correlated to the shrimp growth traits (P is smaller than 10<-6>). The marker is positioned at a 211bp position on the LvSRC gene and belongs to G / Ttype mutation, and the GT genotype of the marker is a distinct growth-dominant genotype. The marker provided by the invention can be used as the shrimp breeding molecular marker for assisting in genetic selection of the shrimp growth traits.

Description

technical field [0001] The invention belongs to the field of aquatic animal breeding, and in particular relates to a molecular marker related to growth traits in the C-type scavenger receptor of Litopenaeus vannamei and its application in growth trait breeding. Background technique [0002] Litopenaeus vannamei, also known as white Pacific shrimp, is one of the most important aquaculture species in the world, accounting for 76% of the world's total shrimp production, and its breeding areas are all over the world. In the past ten years, the aquaculture output of Litopenaeus vannamei has increased year by year, from 1.3 million tons in 2004 to 3.3 million tons in 2013. Litopenaeus vannamei is also the leading species of prawn farming in my country. This species was introduced to my country from the United States in 1988 and has been cultivated in my country on a large scale since 1999. By 2013, the annual output can reach about 1.4 million tons, accounting for the total output...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12Q1/6888C12N15/11
CPCC12Q1/6888C12Q2600/124C12Q2600/156
Inventor李富花王全超于洋相建海
OwnerINST OF OCEANOLOGY - CHINESE ACAD OF SCI