A haplotype marker associated with rapid growth in largemouth bass and its application

A technology for largemouth bass and genotype, which is applied in the field of haplotype marking, can solve the problems of large growth disparity, mutual cannibalism, and insufficient parental quality of largemouth bass, and achieves fast growth rate, direct effect, and reduced blindness effect

Active Publication Date: 2021-08-10
PEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI
View PDF7 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

This method is convenient, fast, and simple, but it is greatly affected by human factors. In addition, largemouth bass is a carnivorous fish with strong predatory nature. If the bait is insufficient, it will eat each other, resulting in a large difference in growth.
It can be seen that judging the parental quality of largemouth bass only from phenotype often does not achieve the desired effect

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • A haplotype marker associated with rapid growth in largemouth bass and its application
  • A haplotype marker associated with rapid growth in largemouth bass and its application
  • A haplotype marker associated with rapid growth in largemouth bass and its application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] Example 1 Obtaining SNP markers related to growth traits of largemouth bass

[0062] The present application found that the amino acid sequence of the largemouth bass HSP70 gene (heat shock protein 70) is shown in SEQ ID NO: 1; its cDNA sequence is shown in SEQ ID NO: 2, wherein the 993rd base is G or A; its gene sequence is shown in SEQ ID NO: 3, which consists of coding region and non-coding region, wherein the 1313th R is the base G or A, and there are two genotypes GA and AA; the 259th K is the base The base T is either a base deletion, and there are two genotypes T- and -- (where "-" indicates a base deletion); the 2302nd S is a base segment CTGTCTTCTGTTCATAAGTGTC (abbreviated as a Y segment) or a base segment deletion , that is, there are two genotypes Y- and -- (where "-" means a base deletion); the 2346th W is a base A or T, and there are two genotypes AT and AA.

[0063] The random population of 430 samples used for correlation analysis in this experiment was ...

Embodiment 2

[0074] Embodiment 2 A kind of method of screening fast-growing largemouth bass

[0075] Utilize above-mentioned SNP locus to screen fast-growing largemouth bass parent, comprise the following steps:

[0076] (1) Primer sequence:

[0077] According to the largemouth bass heat shock protein HSP70 gene sequence, a pair of primers were designed for PCR amplification. The designed and synthesized primers were as follows:

[0078] P1: 5'-CGTCGACTTCTACACCTCCA-3' (SEQ ID NO: 4)

[0079] P2: 5'-TCGTCTGGGTTGATGCTCTT-3' (SEQ ID NO:5)

[0080] The primers are expected to amplify a DNA band with a size of 231bp.

[0081] (2) Sample treatment (alkali lysis method):

[0082] 1. Cut 10-20 mg of fin rays to be tested and put them into a clean EP tube;

[0083] 2. Add 180μL of 50mmol / L NaOH solution, bathe in water for 20min (room temperature), shake several times during the period;

[0084] 3. Add 20 μL of 1mol / L Tris-HCL solution (PH=8.0), and vortex fully;

[0085] 4. Put the sample t...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a haplotype marker related to the rapid growth of largemouth bass and its application. The haplotype marker consists of the 1313th and 2346th positions of the heat shock protein HSP70 genome sequence SEQ ID NO: 3 of the largemouth bass and its application. The SNP site at the 259th base and the insertion-deletion mutation site at the 259th base and the 2302nd base, these 4 sites are completely linked. Utilize the haplotype mark of the present invention, keep the genotypes of the 1313th, 259th, 2302nd, 2346th in production and be respectively the largemouth bass parent of GA, T-, Y-, AT (Y represents the base fragment CTGTCTTCTGTTCATAAGTGTC), remove Individuals of other genotypes can quickly obtain fast-growing and genetically stable largemouth bass varieties.

Description

technical field [0001] The invention belongs to the technical field of molecular biology, and in particular relates to a haplotype marker related to the rapid growth of largemouth bass and an application thereof. Background technique [0002] Largemouth bass (Micropterus salmoides L.), also known as California perch, is native to North America. It has the advantages of strong adaptability, fast growth, less disease, low temperature resistance, short growth cycle and delicious taste. It is an important freshwater cultured fish. one. Introduced from Taiwan to Guangdong Province in 1983, it is now cultivated in most parts of the country. However, over the past 30 years since the introduction of the species, because the production unit did not pay attention to the operating procedures that must be followed for the parents to save the seeds, and failed to regularly supplement and introduce the parents from the place of origin, the genetic diversity of the cultured largemouth bas...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityPatents(China)
IPC IPC(8): C07K14/46C12N15/12C12N15/11C12Q1/6888
CPCC07K14/461C12Q1/6888C12Q2600/124C12Q2600/156
Inventor李胜杰白俊杰赵荦樊佳佳姜鹏孙建国吴建开
OwnerPEARL RIVER FISHERY RES INST CHINESE ACAD OF FISHERY SCI