Molecular marker correlated with tailless phenotype of fat-rumped sheep in China and application of molecular marker
A technology of molecular markers and sheep is applied in the field of genetic biology to achieve the effect of accurate and reliable methods and easy operation
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
specific Embodiment
[0024] chinese sheep T Gene 8:87804590 / 8:87804589 Genotyping.
[0025] 1.1 Extraction of genomic DNA from the blood of local sheep breeds in China
[0026] Blood samples were collected from 225 individual sheep, among which fat hip sheep included 32 Kazakh sheep, 25 Altay sheep, 15 Bashibai sheep, 20 Duolang sheep, and 21 Bayinbulak sheep; long thin tail sheep Sheep include 32 Gansu alpine fine-wool sheep, 12 alpine Merino sheep, and 12 Texel sheep; short thin-tailed sheep include 32 Gansu Ola Tibetan sheep; short fat-tailed sheep include 12 Tan sheep, 12 Hu Goat blood samples, using conventional methods to extract the genomic DNA in the blood.
[0027] 1.2 Amplify the nucleotide fragment containing the target SNP site
[0028] According to the Ensemble database T The sequence of the gene is ENSOARG00000004863.1, and the designed primers are as follows:
[0029] Forward primer: 5'- GCTCTCTGCCACAAGAAGGT -3', SEQ ID No.1;
[0030] Reverse primer: 5'- GCATGCGGATCTAGGTGAGT -...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap