Molecular marker for high lysine maize Opaque7 gene and application thereof

A molecular marker, high lysine technology, applied in the direction of DNA/RNA fragment, recombinant DNA technology, etc., can solve the problem of not obtaining co-dominant DNA molecular markers, unable to assist selection, etc., to achieve high accuracy and simple operation. Effect

Inactive Publication Date: 2012-07-18
SHANGHAI UNIV
View PDF2 Cites 9 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Previous studies have not obtained O7 It is a co-dominant DNA molecular marker that is completely linked to the gene, so it is impossible to perform DNA molecular marker-assisted selection on the target traits controlled by the gene.

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker for high lysine maize Opaque7 gene and application thereof
  • Molecular marker for high lysine maize Opaque7 gene and application thereof
  • Molecular marker for high lysine maize Opaque7 gene and application thereof

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0026] Example 1: Using o7 Mutant (o7 / o7) breeding high lysine maize

[0027] because o7 The mutants had 20.7%, 33.4% and 15.1% lower total protein, gliadin and non-gliadin contents in the endosperm, respectively, compared to their wild-type counterparts, see figure 1 , lysine (lys) content increased by 38.2%, see figure 2 , so the high lysine maize can be cultivated by using this gene to cross with other excellent varieties. Bundle o7Mutant homozygotes (o7 / o7) were crossed with other maize with excellent production traits, then the F1 generation was selfed, and a recessive homozygote of high lysine maize grain was isolated in the F2 generation. The recessive homozygote undergoes multi-generation selfing, recurrent selection, and successive generations to select seeds with good grain development and high lysine content, and finally obtain a stable recessive homozygous, high lysine inbred line or population, that is, to obtain High lysine commercial corn.

Embodiment 2

[0028] Example 2: Acquisition of co-dominant molecular markers and O7 Determination of gene linkage

[0029] image 3 and Figure 4 Outline diagram of wild type (+ / +) and homozygous mutant (O7 / O7) of corn kernel. F1 (O7 / +) was obtained by crossing the homozygous mutant (O7 / O7) with the homozygous wild-type (+ / +), and then backcrossing was performed with F1 as the female parent and the homozygous mutant as the male parent to construct a backcross ( BC) groups, see Figure 5 . Genotypic segregation occurred in the BC population, including both O7 / + and O7 / O7 genotypes, see Image 6 , the grains with O7 / + genotype and + / + genotype are non-Opaque wild-type grains, and the grains with O7 / O7 genotype are Opaque mutant types.

[0030] The present invention is known by classical genetic mapping O7 The gene is located on the long arm of maize chromosome 10 (Bin10.07). Through the backcross population (BC) constructed for homozygous mutants and homozygous wild-type plants near t...

Embodiment 3

[0035] Example 3: Polymorphism identification of molecular markers among different parents

[0036] Genomic DNA of 539 inbred lines widely used in breeding of o7 / o7 mutants, wild-type pure and B73, Mo17, W22, W64A, BSSS53, etc. were extracted, and the polymorphism among different varieties was analyzed by PCR reaction . The results show that using the molecular marker 6837D in the present invention o7 PCR amplification and gel electrophoresis analysis of 539 middle-breeding parent DNAs with B73, Mo17, W22, W64A, BSSS53, etc. showed that 6837D was in o7 It has polymorphism with 539 breeding parents such as B73, Mo17, W22, W64A, BSSS53, etc., see Figure 8 . This result demonstrates that the molecular marker 6837D can be accurately detected in any breeding background population o7 The presence of genes that can be used when breeding high lysine maize with these breeding materials o7 Assisted selection of genes with 0 mis-selection rate.

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention relates to a molecular marker for high lysine maize Opaque7 gene and application thereof. The molecular marker is the codominant molecular marker 6837D which is obtained through PCR amplification of specific primers, and base sequences of the specific primers are as follows: a forward primer has a base sequence of, from 5' terminal to 3' terminal, CCACGGAAGCCCGGGTCAGT, and a reverse primer has a base sequence of, from 5' terminal to 3' terminal, GCGTCCACCTCGATCGGGG. By using the molecular marker in complete linkage with the O7 gene, genotype identification of DNA of any tissue of maize at any stage can be carried out, and the situation of existence and the state of heterozygosis or homozygosis of the O7 gene in each individual plant of a crossbreeding filial generation can be detected; meanwhile, by using the molecular marker, mutants and main domestic breeding parents of 539 species can be differentiated, the O7 gene in a colony of any breeding background can be accurately detected, and the rate of wrong choice is 0. A detection method provided in the invention has high accuracy, is simple to operate and provides a technical approach for DNA molecular marker-assisted selection of the O7 gene.

Description

technical field [0001] The present invention relates to a molecular marker of high lysine maize Opaque7 gene and its application. technical background [0002] corn( Zea mays L.) is the main food and feed crop in the world and also in my country. Since 1995, the total output of maize in my country has surpassed that of wheat, becoming the second largest food crop after rice. According to FAO statistics, since 1998, the total output of maize has surpassed wheat and rice to become the world's largest food crop. As an important source of food, feed and fuel, the global demand and consumption of corn is increasing dramatically. It is estimated that by 2017, annual global corn and wheat production will need to increase by another 200 million tons to meet world demand. In order to cope with the world food crisis and ensure my country's food security, the State Council has put forward the strategic goal of increasing grain production by another 100 billion catties by 2020, of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12N15/11C12Q1/68
Inventor王刚樊向瑜王树詹红蕊孙鑫王桂凤王飞宋任涛许政暟
OwnerSHANGHAI UNIV