In situ overexpression vector pGV64 and application

An overexpression, GV64 technology, applied in the field of genetic engineering, achieves the effects of easy use, avoiding false phenotypes, and good application prospects

Active Publication Date: 2018-07-06
TOBACCO RES INST CHIN AGRI SCI ACAD
View PDF3 Cites 0 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

By constructing its own promoter to drive gene expression, the gene can be expressed at the in situ level, but the expression degree of this expression obviously depends on the expression strength of the gene promoter

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • In situ overexpression vector pGV64 and application
  • In situ overexpression vector pGV64 and application
  • In situ overexpression vector pGV64 and application

Examples

Experimental program
Comparison scheme
Effect test

preparation example Construction

[0031] Another embodiment of the present invention provides a method for preparing the above-mentioned in situ overexpression vector pGV64, comprising the following steps: synthesizing a T vector containing the nucleotide sequence GV64, and the two ends of the nucleotide sequence GV64 contain SacI and BglII restriction sites , the above T vector and pCAMBIA3301 vector were digested with Sac I and Bgl II respectively, and the digested fragments were ligated under the catalysis of T4 ligase to obtain vector pGV64.

[0032] Another embodiment of the present invention provides the application of the above-mentioned in situ overexpression vector pGV64 in regulating the in situ overexpression of Arabidopsis genes.

Embodiment 1

[0034] Construction of embodiment 1 vector pGV64

[0035] (1) Using gene synthesis technology to synthesize GV64-T, the nucleotide sequence GV64 containing the above-mentioned functional elements is connected to the T vector (both ends contain SacI and BgIII restriction endonuclease sites), and the sequence of GV64 is as SEQ ID No As shown in :10, the size is 1389bp.

[0036] (2) SacⅠ and BglⅡ digestion:

[0037] The GV64-T (100ng / μL) and pCAMBIA3301 (100ng / μL) vectors were digested with SacⅠ and BglⅡ respectively, the method is as follows:

[0038] Establish enzyme digestion system (100μL):

[0039] name

Amount added

SacⅠ(BglⅡ)

2.4 μL

carrier

15μL

10×NEB buffer

10μL

Ultra-pure water

Make up to 100μL

[0040] React at 37°C for 3 hours.

[0041] See pCAMBIA3301 Vector Schematic figure 1 .

[0042] After the reaction, 1.2% agarose gel electrophoresis, and use the gel recovery kit (Quanshijin Biotechnology Co., Ltd...

Embodiment 2

[0050] Example 2 Functional verification of in situ overexpression vector pGV64

[0051] 1. Construction of proIDA-pGV64 vector

[0052] (1) Amplify the IDA gene promoter sequence

[0053] Take the Arabidopsis col that has grown for 20 days, and take the leaves to extract genomic DNA. Using this as a template, the sequence of the amplification primers is as follows:

[0054] GV64_PROMOTER_IDAF:ATGATTACGAATTCGAGCTCAACCCTCGTTCTGAATCAAAGGGT;

[0055] GV64_PROMOTER_IDAR:CCTCAGATCTGGATCCTTGGTAGTCAATGTTTTTTTTCTTCTC;

[0056] Set the amplification program, and use the PCR instrument to amplify the target fragment: 95°C for 3 minutes, (95°C for 30s, 56°C for 30s, 72°C for 1min30s) for 32 cycles, 72°C for 10 minutes, and keep warm at 25°C;

[0057] The PCR product was subjected to gel electrophoresis and gel-cutting to recover (using Quanshijin's kit) to obtain the purified IDA promoter fragment.

[0058] (2) Use the infusion enzyme system to connect the IDA promoter fragment into ...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention provides an in situ overexpression vector pGV64 and an application, and belongs to the field of genetic engineering. According to the invention, an effective combination of different components such as Omega sequence, 4*VP16, and GAL4 and the like are used to convert gene expression into transcription factor activation; a self-promoter of a gene is introduced to drive the expressionof trans-acting factor GAL4-BD fusing with VP64, to promote the expression level of the gene itself, and to enhance the expression rate of the gene at in situ levels. The in situ overexpression vectorpGV64 comprises a pCAMBIA3301 vector and the following cis-linked functional elements: OMega, the sequence is shown as SEQ ID No: 1; Kozak, the sequence is shown in SEQ ID No: 2; 3*Flag, the sequenceis shown as SEQ ID No: 3; GAL4-BD, the sequence is shown as SEQ ID No: 4; NLS, the sequence is shown as SEQ ID No: 5; VP64, the sequence is shown as SEQ ID No: 6; Nos-Terminal-5XUAS, the sequence isshown as SEQ ID No: 7; minimal 35S, the sequence is shown as SEQ ID No: 8; and 4*MYC, the sequence is shown as SEQ ID No: 9.

Description

technical field [0001] The invention relates to the field of genetic engineering, in particular to an in situ overexpression vector pGV64 and its application. Background technique [0002] Overexpression refers to a technology that significantly increases the expression of the gene under study through some techniques. As a research method, overexpression has an important application in the process of gene function analysis. At present, in the study of plant gene function, constitutive promoters are usually used to drive gene overexpression, such as tobacco mosaic virus CaMV 35S, maize ubiquitin promoter ubi, plant housekeeping gene promoter actin, etc. This type of promoter has the characteristics of high expression, but the disadvantage of constitutive promoter is that it cannot control the position of gene expression, so that the overexpressed gene has no selectivity in tissue specificity, resulting in ectopic expression of the gene. The result of ectopic expression is th...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/82C12N15/66A01H5/00A01H6/20
CPCC12N15/66C12N15/8216
Inventor张增林郭永峰李伟高晓明徐萌萌
OwnerTOBACCO RES INST CHIN AGRI SCI ACAD